OAT-ornithine aminotransferase (gyrate atrophy) Gene View larger

OAT-ornithine aminotransferase (gyrate atrophy) Gene

PTXBC016928

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OAT-ornithine aminotransferase (gyrate atrophy) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OAT-ornithine aminotransferase (gyrate atrophy) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016928
Product type: DNA & cDNA
Ncbi symbol: OAT
Origin species: Human
Product name: OAT-ornithine aminotransferase (gyrate atrophy) Gene
Size: 2ug
Accessions: BC016928
Gene id: 4942
Gene description: ornithine aminotransferase (gyrate atrophy)
Synonyms: GACR; HOGA; OATASE; OKT; ornithine aminotransferase, mitochondrial; gyrate atrophy; ornithine delta-aminotransferase; ornithine-oxo-acid aminotransferase; testicular tissue protein Li 130
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttttccaaactagcacatttgcagaggtttgctgtacttagtcgcggagttcattcttcagtggcttctgctacatctgttgcaactaaaaaaacagtccaaggccctccaacctctgatgacatttttgaaagggaatataagtatggtgcacacaactaccatcctttacctgtagccctggagagaggaaaaggtatttacttatgggatgtagaaggcagaaaatattttgacttcctgagttcttacagtgctgtcaaccaagggcattgtcaccccaagattgtgaatgctctgaagagtcaagtggacaaattgaccttaacatctagagctttctataataacgtacttggtgaatatgaggagtatattactaaacttttcaactaccacaaagttcttcctatgaatacaggagtggaggctggagagactgcctgtaaactagctcgtaagtggggctataccgtgaagggcattcagaaatacaaagcaaagattgtttttgcagctgggaacttctggggtaggacgttgtctgctatctccagttccacagacccaaccagttacgatggttttggaccatttatgccgggattcgacatcattccctataatgatctgcccgcactggagcgtgctcttcaggatccaaatgtggctgcgttcatggtagaaccaattcagggtgaagcaggcgttgttgttccggatccaggttacctaatgggagtgcgagagctctgcaccaggcaccaggttctctttattgctgatgaaatacagacaggattggccagaactggtagatggctggctgttgattatgaaaatgtcagacctgatatagtcctccttggaaaggccctttctgggggcttataccctgtgtctgcagtgctgtgtgatgatgacatcatgctgaccattaagccaggggagcatgggtccacatacggtggcaatccactaggctgccgagtggccatcgcagcccttgaggttttagaagaagaaaaccttgctgaaaatgcagacaaattgggcattatcttgagaaatgaactcatgaagctaccttctgatgttgtaactgccgtaagaggaaaaggattattaaacgctattgtcattaaagaaaccaaagattgggatgcttggaaggtgtgtctacgacttcgagataatggacttctggccaagccaacccatggcgacattatcaggtttgcgcctccgctggtgatcaaggaggatgagcttcgagagtccattgaaattattaacaagaccatcttgtctttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - integrin alpha FG-GAP repeat containing 2
- non-SMC condensin II complex, subunit H2
- zinc finger and BTB domain containing 43
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Buy OAT-ornithine aminotransferase (gyrate atrophy) Gene now

Add to cart