NCAPH2-non-SMC condensin II complex, subunit H2 Gene View larger

NCAPH2-non-SMC condensin II complex, subunit H2 Gene

PTXBC014939

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCAPH2-non-SMC condensin II complex, subunit H2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NCAPH2-non-SMC condensin II complex, subunit H2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014939
Product type: DNA & cDNA
Ncbi symbol: NCAPH2
Origin species: Human
Product name: NCAPH2-non-SMC condensin II complex, subunit H2 Gene
Size: 2ug
Accessions: BC014939
Gene id: 29781
Gene description: non-SMC condensin II complex, subunit H2
Synonyms: CAPH2; condensin-2 complex subunit H2; CAP-H2 subunit of the condensin II complex; CTA-384D8.36; chromosome-associated protein H2; kleisin beta; non-SMC condensin II complex subunit H2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctggtggcccctgatgaaatggagaagaacaacaatcccctgtacagccgtcagggtgaggtcctggccagccggaaggatttcaggatgaacacgtgcgttccccaccccagaggggccttcatgttggagccagagggcatgtcccccatggaaccagcgggcgtttcccccatgccagggacccagaaggacaccgggaggactgaggagcagccaatggaagtttccgtgtgcaggagccctgtcccagcactcggcttctcccaggagccaggcccctctccagaaggcccgatgcccctgggtgggggcgaggacgaggatgcagaggaggcagtagagcttcctgaggcctcggcccccaaggccgctctggagcccaaggagtccaggagcccgcagcagagtgctgccctgcccaggaggtacatgctgcgggagcgggagggggccccagagcctgcatcctgcgtgaaggagactccagacccctggcagagcctggacccctttgactccttggagtctaagcccttcaagaaaggtaggccttactctgtgcccccctgtgtggaggaggctctgggacagaagcgcaagaggaagggcgctgccaagctgcaggacttccaccagtggtacctggctgcctatgcagaccatgccgacagcaggcggcttcggcgaaagggtccgtcctttgcagacatggaggtcctgtactggacacacgtgaaggagcagttggaaactctccggaagctgcagaggagggaggtggctgagcagtggctgcggcctgcagaggaggaccacctggaggattccctggaagacctgggggcagcagatgactttctagagcctgaggagtacatggagcccgagggagcagaccccagggaagccgctgaccttgacgcagtgccgatgtccctgagctacgaggagctggttcgaaggaatgtggagctcttcatcgccacctcccagaagtttgtccaggagacagagctgagccagcgcatcagggactgggaggacacagtgcagcctctgctccaggagcaggagcagcatgtgccctttgacatccacacctatggggaccagctggtctcacggttcccccagctcaatgagtggtgtccctttgcggagctggtggctggccagccggccttcgaggtgtgtcgttccatgctggcctccctgcagctggccaatgactacacagtggagataacccagcagcccgggctggagatggccgtggacaccatgtccctgagactgctcacgcaccagcgagcgcacaagcgcttccagacctacgctgccccctccatggcccagccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and BTB domain containing 43
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
- cholesteryl ester transfer protein, plasma
- cholinergic receptor, nicotinic, alpha 3

Buy NCAPH2-non-SMC condensin II complex, subunit H2 Gene now

Add to cart