DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene View larger

DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene

PTXBC002674

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002674
Product type: DNA & cDNA
Ncbi symbol: DDX49
Origin species: Human
Product name: DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene
Size: 2ug
Accessions: BC002674
Gene id: 54555
Gene description: DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Synonyms: R27090_2; DEAD (Asp-Glu-Ala-Asp) box polypeptide 49; DEAD box protein 49; DEAD-box helicase 49
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcttcgcggagctcgggctgtcatcgtggctcgtggaacaatgtcggcagctgggtttgaagcagcccacgcccgtgcagctcggctgcatccccgccatcctggagggtcgagactgcttgggctgtgctaagacaggcagtgggaagacagcagcgtttgtccttcccatcttgcagaagctgtctgaggatccctatggcatcttctgcctcgtcctgacacccaccagggagctggcctaccagatcgcagagcagttccgggtcctggggaagcctctagggctgaaagactgcatcatcgtcggtggcatggacatggtggcccaggcgctggagctctctcggaaaccacacgtggtcatcgccacgccggggcgcctggcagatcacctgcgcagctccaacacttttagtataaagaagatccgcttcctggtgatggatgaggcagaccggctgctggaacagggctgcactgacttcaccgtggacctggaggccatcctggcggctgtgccggcccgcaggcagacactgctgttcagcgccacgctgaccgacacactccgggagctgcagggtctggccaccaaccagcccttcttctgggaagcacaggccccggtgagcaccgtggagcagctggaccagcgctacctgctggtgcctgagaaggtcaaggacgcctacctggtccacctgatccagcgcttccaggatgagcacgaggactggtccattatcatcttcaccaacacgtgcaagacctgccagattctgtgcatgatgctgcgcaaattcagcttccccaccgtggctctgcactccatgatgaagcagaaagaacgctttgccgccctagccaagttcaagtccagcatctaccggatcctgatcgcaacagacgtggcctcccggggcctggacatccctacggtacaggtggtcatcaaccacaacacccccgggctccccaagatctacatccaccgagtcggccggacggcccgtgcagggcggcagggtcaggccatcacgctggtgacacagtacgacatccacctggtgcacgccatcgaggagcagatcaagaagaagctggaggagttctccgtggaagaggccgaggtgctacagatcctcacacaggtcaacgtggtgcgaagagagtgtgagatcaaactggaggcggcccactttgacgaaaagaaggagatcaacaaacggaagcagctgatcctggaggggaaggaccctgacctggaggccaagcgcaaggctgagctggccaagatcaagcagaagaaccggcgcttcaaggagaaggtggaggagacgctgaagcgacagaaggctggcagggctggccacaaggggcgtccacccaggacaccgtctgggtcccactcaggcccagtcccctcccagggcctggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cholesteryl ester transfer protein, plasma
- cholinergic receptor, nicotinic, alpha 3
- non-SMC condensin II complex, subunit H2
- non-SMC condensin II complex, subunit H2

Buy DDX49-DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Gene now

Add to cart