ITFG2-integrin alpha FG-GAP repeat containing 2 Gene View larger

ITFG2-integrin alpha FG-GAP repeat containing 2 Gene

PTXBC006552

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ITFG2-integrin alpha FG-GAP repeat containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ITFG2-integrin alpha FG-GAP repeat containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006552
Product type: DNA & cDNA
Ncbi symbol: ITFG2
Origin species: Human
Product name: ITFG2-integrin alpha FG-GAP repeat containing 2 Gene
Size: 2ug
Accessions: BC006552
Gene id: 55846
Gene description: integrin alpha FG-GAP repeat containing 2
Synonyms: MDS028; integrin-alpha FG-GAP repeat-containing protein 2; integrin alpha FG-GAP repeat containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtcagttagctacgtgcagcgcgtggcgctggagttcagcgggagcctcttcccgcacgcaatctgcctcggagacgttgataacgatacgttaaatgaactggtggtgggagacaccagcgggaaggtgtctgtgtataaaaatgatgacagtcggccatggctcacctgttcctgccagggaatgctgacttgcgttggggttggagacgtgtgtaataaaggaaagaacctgttggtggcagtgagtgctgaaggctggtttcatttgtttgacctgacacctgccaaggtgttggatgcttctgggcaccacgagacactaatcggagaggagcagcgtccagtcttcaagcagcacatccctgccaacaccaaggtcatgctgatcagcgacatcgatggagatgggtgtcgtgagctggtggtgggctacacagaccgtgtggtgcgagctttccgctgggaggagctaggtgagggtcctgaacatctgacagggcagctggtgtccctcaagaaatggatgctggagggtcaggtggacagcctctcagtgactctggggccactgggtcttcctgaactgatggtgtctcagccaggttgtgcgtatgcaattctactgtgtacctggaaaaaggacactgggtcccctcctgcctctgaagggcccacggatggtagtagggagaccccagctgcccgagacgtggtgctgcaccagacatctggccgtatccacaacaagaatgtctccactcacctaattggcaacatcaaacaaggccacggcactgagagtagtggctctggcctctttgccctgtgcaccctggatgggacactgaagctcatggaagaaatggaagaagcagacaagctgctgtggtcagtgcaggtggatcaccagctctttgccctggagaaactggatgtcaccggcaacgggcatgaggaggtagttgcatgcgcctgggatggacagacatatatcattgatcacaaccgcaccgtcgtccgcttccaagtggatgaaaatatccgtgccttctgtgcaggcctgtacgcctgcaaagagggccgcaacagcccctgcctcgtatatgtcactttcaaccagaagatctatgtgtactgggaggtgcagctggagcggatggagtctaccaatctggtgaaactgctggagaccaagccggagtaccacagcctgctgcaggagctgggcgtggatcctgacgacctccctgtgactcgtgccctgcttcaccaaacgctctaccatccagaccagccaccacagtgtgctccctcaagcctccaggatcccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-SMC condensin II complex, subunit H2
- zinc finger and BTB domain containing 43
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
- cholesteryl ester transfer protein, plasma

Buy ITFG2-integrin alpha FG-GAP repeat containing 2 Gene now

Add to cart