XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene View larger

XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001036
Product type: DNA & cDNA
Ncbi symbol: XRCC3
Origin species: Human
Product name: XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene
Size: 2ug
Accessions: BC001036
Gene id: 7517
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms: DNA repair protein XRCC3; CMM6; X-ray repair complementing defective repair in Chinese hamster cells 3; X-ray repair cross-complementing protein 3; X-ray repair cross complementing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatttggatctactggacctgaatcccagaattattgctgcaattaagaaagccaaactgaaatcggtaaaggaggttttacacttttctggaccagacttgaagagactgaccaacctctccagccccgaggtctggcacttgctgagaacggcctccttacacttgcggggaagcagcatccttacagcactgcagctgcaccagcagaaggagcggttccccacgcagcaccagcgcctgagcctgggctgcccggtgctggacgcgctgctccgcggtggcctgcccctggacggcatcactgagctggccggacgcagctcggcagggaagacccagctggcgctgcagctctgcctggctgtgcagttcccgcggcagcacggaggcctggaggctggagccgtctacatctgcacggaagacgccttcccgcacaagcgcctgcagcagctcatggcccagcagccgcggctgcgcactgacgttccaggagagctgcttcagaagctccgatttggcagccagatcttcatcgagcacgtggccgatgtggacaccttgttggagtgtgtgaataagaaggtccccgtactgctgtctcggggcatggctcgcctggtggtcatcgactcggtggcagccccattccgctgtgaatttgacagccaggcctccgcccccagggccaggcatctgcagtccctgggggccacgctgcgtgagctgagcagtgccttccagagccctgtgctgtgcatcaaccaggtgacagaggccatggaggagcagggcgcagcacacgggccgctggggttctgggacgaacgtgtttccccagcccttggcataacctgggctaaccagctcctggtgagactgctggctgaccggctccgcgaggaagaggctgccctcggctgcccagcccggaccctgcgggtgctctctgccccccacctgcccccctcctcctgttcctacacgatcagtgccgaaggggtgcgagggacacctgggacccagtcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - activating transcription factor 4 (tax-responsive enhancer element B67)
- activating transcription factor 4 (tax-responsive enhancer element B67)
- apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D
- solute carrier family 37 (glucose-6-phosphate transporter), member 4

Buy XRCC3-X-ray repair complementing defective repair in Chinese hamster cells 3 Gene now

Add to cart