Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene
PTXBC016855
New product
Data sheet of ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016855 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATF4 |
| Origin species: | Human |
| Product name: | ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene |
| Size: | 2ug |
| Accessions: | BC016855 |
| Gene id: | 468 |
| Gene description: | activating transcription factor 4 (tax-responsive enhancer element B67) |
| Synonyms: | CREB-2; CREB2; TAXREB67; TXREB; cyclic AMP-dependent transcription factor ATF-4; DNA-binding protein TAXREB67; cAMP response element-binding protein 2; cAMP-dependent transcription factor ATF-4; cAMP-responsive element-binding protein 2; cyclic AMP-responsive element-binding protein 2; tax-responsive enhancer element B67; tax-responsive enhancer element-binding protein 67; activating transcription factor 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccgaaatgagcttcctgagcagcgaggtgttggtgggggacttgatgtcccccttcgaccagtcgggtttgggggctgaagaaagcctaggtctcttagatgattacctggaggtggccaagcacttcaaacctcatgggttctccagcgacaaggctaaggcgggctcctccgaatggctggctgtggatgggttggtcagtccctccaacaacagcaaggaggatgccttctccgggacagattggatgttggagaaaatggatttgaaggagttcgacttggatgccctgttgggtatagatgacctggaaaccatgccagatgaccttctgaccacgttggatgacacttgtgatctctttgcccccctagtccaggagactaataagcagcccccccagacggtgaacccaattggccatctcccagaaagtttaacaaaacccgaccaggttgcccccttcaccttcttacaacctcttcccctttccccaggggtcctgtcctccactccagatcattcctttagtttagagctgggcagtgaagtggatatcactgaaggagataggaagccagactacactgcttacgttgccatgatccctcagtgcataaaggaggaagacaccccttcagataatgatagtggcatctgtatgagcccagagtcctatctggggtctcctcagcacagcccctctaccaggggctctccaaataggagcctcccatctccaggtgttctctgtgggtctgcccgtcccaaaccttacgatcctcctggagagaagatggtagcagcaaaagtaaagggtgagaaactggataagaagctgaaaaaaatggagcaaaacaagacagcagccactaggtaccgccagaagaagagggcggagcaggaggctcttactggtgagtgcaaagagctggaaaagaagaacgaggctctaaaagagagggcggattccctggccaaggagatccagtacctgaaagatttgatagaagaggtccgcaaggcaagggggaagaaaagggtcccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D - solute carrier family 37 (glucose-6-phosphate transporter), member 4 - X-ray repair complementing defective repair in Chinese hamster cells 6 - amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) |