Login to display prices
Login to display prices
ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene View larger

ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene

PTXBC016855

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene

Proteogenix catalog: PTXBC016855
Ncbi symbol: ATF4
Product name: ATF4-activating transcription factor 4 (tax-responsive enhancer element B67) Gene
Size: 2ug
Accessions: BC016855
Gene id: 468
Gene description: activating transcription factor 4 (tax-responsive enhancer element B67)
Synonyms: CREB-2; CREB2; TAXREB67; TXREB; cyclic AMP-dependent transcription factor ATF-4; DNA-binding protein TAXREB67; cAMP response element-binding protein 2; cAMP-dependent transcription factor ATF-4; cAMP-responsive element-binding protein 2; cyclic AMP-responsive element-binding protein 2; tax-responsive enhancer element B67; tax-responsive enhancer element-binding protein 67; activating transcription factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgaaatgagcttcctgagcagcgaggtgttggtgggggacttgatgtcccccttcgaccagtcgggtttgggggctgaagaaagcctaggtctcttagatgattacctggaggtggccaagcacttcaaacctcatgggttctccagcgacaaggctaaggcgggctcctccgaatggctggctgtggatgggttggtcagtccctccaacaacagcaaggaggatgccttctccgggacagattggatgttggagaaaatggatttgaaggagttcgacttggatgccctgttgggtatagatgacctggaaaccatgccagatgaccttctgaccacgttggatgacacttgtgatctctttgcccccctagtccaggagactaataagcagcccccccagacggtgaacccaattggccatctcccagaaagtttaacaaaacccgaccaggttgcccccttcaccttcttacaacctcttcccctttccccaggggtcctgtcctccactccagatcattcctttagtttagagctgggcagtgaagtggatatcactgaaggagataggaagccagactacactgcttacgttgccatgatccctcagtgcataaaggaggaagacaccccttcagataatgatagtggcatctgtatgagcccagagtcctatctggggtctcctcagcacagcccctctaccaggggctctccaaataggagcctcccatctccaggtgttctctgtgggtctgcccgtcccaaaccttacgatcctcctggagagaagatggtagcagcaaaagtaaagggtgagaaactggataagaagctgaaaaaaatggagcaaaacaagacagcagccactaggtaccgccagaagaagagggcggagcaggaggctcttactggtgagtgcaaagagctggaaaagaagaacgaggctctaaaagagagggcggattccctggccaaggagatccagtacctgaaagatttgatagaagaggtccgcaaggcaagggggaagaaaagggtcccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: