SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene View larger

SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014663
Product type: DNA & cDNA
Ncbi symbol: SLC37A4
Origin species: Human
Product name: SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene
Size: 2ug
Accessions: BC014663
Gene id: 2542
Gene description: solute carrier family 37 (glucose-6-phosphate transporter), member 4
Synonyms: glucose-6-phosphate exchanger SLC37A4; G6PT1; G6PT2; G6PT3; GSD1b; GSD1c; GSD1d; PRO0685; TRG-19; TRG19; glucose-5-phosphate transporter; glucose-6-phosphatase, transport (glucose) protein 3; glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1; glucose-6-phosphatase, transport (phosphate/pyrophosphate) protein 2; glucose-6-phosphate translocase; microsomal glucose-6-phosphate transporter; solute carrier family 37 (glucose-6-phosphate transporter), member 4; transformation-related gene 19 protein; solute carrier family 37 member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcccagggctatggctattatcgcactgtgatcttctcagccatgtttgggggctacagcctgtattacttcaatcgcaagaccttctcctttgtcatgccatcattggtggaagagatccctttggacaaggatgatttggggttcatcaccagcagccagtcggcagcttatgctatcagcaagtttgtcagtggggtgctgtctgaccagatgagtgctcgctggctcttctcttctgggctgctcctggttggcctggtcaacatattctttgcctggagctccacagtacctgtctttgctgccctctggttccttaatggcctggcccaggggctgggctggcccccatgtgggaaggtcctgcggaagtggtttgagccatctcagtttggcacttggtgggccatcctgtcaaccagcatgaacctggctggagggctgggccctatcctggcaaccatccttgcccagagctacagctggcgcagcacgctggccctatctggggcactgtgtgtggttgtctccttcctctgtctcctgctcatccacaatgaacctgctgatgttggactccgcaacctggaccccatgccctctgagggcaagaagggctccttgaaggaggagagcaccctgcaggagctgctgctgtccccttacctgtgggtgctctccactggttaccttgtggtgtttggagtaaagacctgctgtactgactggggccagttcttccttatccaggagaaaggacagtcagcccttgtaggtagctcctacatgagtgccctggaagttgggggccttgtaggcagcatcgcagctggctacctgtcagaccgggccatggcaaaggcgggactgtccaactacgggaaccctcgccatggcctgttgctgttcatgatggctggcatgacagtgtccatgtacctcttccgggtaacagtgaccagtgactcccccaagctctggatcctggtattgggagctgtatttggtttctcctcgtatggccccattgccctgtttggagtcatagccaacgagagtgcccctcccaacttgtgtggcacctcccacgccattgtgggactcatggccaatgtgggcggctttctggctgggctgcccttcagcaccattgccaagcactacagttggagcacagccttctgggtggctgaagtgatttgtgcggccagcacggctgccttcttcctcctacgaaacatccgcaccaagatgggccgagtgtccaagaaggctgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - X-ray repair complementing defective repair in Chinese hamster cells 6
- amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
- apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
- protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform

Buy SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene now

Add to cart