Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene
PTXBC014663
New product
Data sheet of SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC37A4 |
| Origin species: | Human |
| Product name: | SLC37A4-solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC014663 |
| Gene id: | 2542 |
| Gene description: | solute carrier family 37 (glucose-6-phosphate transporter), member 4 |
| Synonyms: | glucose-6-phosphate exchanger SLC37A4; G6PT1; G6PT2; G6PT3; GSD1b; GSD1c; GSD1d; PRO0685; TRG-19; TRG19; glucose-5-phosphate transporter; glucose-6-phosphatase, transport (glucose) protein 3; glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1; glucose-6-phosphatase, transport (phosphate/pyrophosphate) protein 2; glucose-6-phosphate translocase; microsomal glucose-6-phosphate transporter; solute carrier family 37 (glucose-6-phosphate transporter), member 4; transformation-related gene 19 protein; solute carrier family 37 member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcccagggctatggctattatcgcactgtgatcttctcagccatgtttgggggctacagcctgtattacttcaatcgcaagaccttctcctttgtcatgccatcattggtggaagagatccctttggacaaggatgatttggggttcatcaccagcagccagtcggcagcttatgctatcagcaagtttgtcagtggggtgctgtctgaccagatgagtgctcgctggctcttctcttctgggctgctcctggttggcctggtcaacatattctttgcctggagctccacagtacctgtctttgctgccctctggttccttaatggcctggcccaggggctgggctggcccccatgtgggaaggtcctgcggaagtggtttgagccatctcagtttggcacttggtgggccatcctgtcaaccagcatgaacctggctggagggctgggccctatcctggcaaccatccttgcccagagctacagctggcgcagcacgctggccctatctggggcactgtgtgtggttgtctccttcctctgtctcctgctcatccacaatgaacctgctgatgttggactccgcaacctggaccccatgccctctgagggcaagaagggctccttgaaggaggagagcaccctgcaggagctgctgctgtccccttacctgtgggtgctctccactggttaccttgtggtgtttggagtaaagacctgctgtactgactggggccagttcttccttatccaggagaaaggacagtcagcccttgtaggtagctcctacatgagtgccctggaagttgggggccttgtaggcagcatcgcagctggctacctgtcagaccgggccatggcaaaggcgggactgtccaactacgggaaccctcgccatggcctgttgctgttcatgatggctggcatgacagtgtccatgtacctcttccgggtaacagtgaccagtgactcccccaagctctggatcctggtattgggagctgtatttggtttctcctcgtatggccccattgccctgtttggagtcatagccaacgagagtgcccctcccaacttgtgtggcacctcccacgccattgtgggactcatggccaatgtgggcggctttctggctgggctgcccttcagcaccattgccaagcactacagttggagcacagccttctgggtggctgaagtgatttgtgcggccagcacggctgccttcttcctcctacgaaacatccgcaccaagatgggccgagtgtccaagaaggctgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-ray repair complementing defective repair in Chinese hamster cells 6 - amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C - protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform |