APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene View larger

APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017022
Product type: DNA & cDNA
Ncbi symbol: APOBEC3D
Origin species: Human
Product name: APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene
Size: 2ug
Accessions: BC017022
Gene id: 140564
Gene description: apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D
Synonyms: A3D; APOBEC3DE; APOBEC3E; ARP6; DNA dC->dU-editing enzyme APOBEC-3D; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene; apolipoprotein B mRNA editing enzyme catalytic subunit 3D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccacagatcagaaatccgatggagcggatgtatcgagacacattctacgacaactttgaaaacgaacccatcctctatggtcggagctacacttggctgtgctatgaagtgaaaataaagaggggccgctcaaatctcctttgggacacaggggtctttcgaggcccggtactacccaaacgtcagtcgaatcacaggcaggaggtgtatttccggtttgagaaccacgcagaaatgtgcttcttatcttggttctgtggcaaccgactgcctgctaacaggcgcttccagatcacctggtttgtatcatggaacccctgcctgccctgtgtggtgaaggtgaccaaattcttggctgagcaccccaatgtcaccctgaccatctctgccgcccgcctctactactaccgggatagagattggcggtgggtgctcctcaggctgcataaggcaggggcccgtgtgaagatcatggactatgaagactttgcatactgctgggaaaactttgtgtgcaatgaaggtcagccattcatgccttggtacaaattcgatgacaattatgcatccctgcaccgcacgctaaaggagattctcagaaacccgatggaggcaatgtacccacacatattctacttccactttaaaaacctactgaaagcctgtggtcggaacgaaagctggctgtgcttcaccatggaagttacaaagcaccactcagctgtcttccggaagaggggcgtcttccgaaaccaggtggatcctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgtgacgacatactgtctcctaacacaaactacgaggtcacctggtacacatcttggagcccttgcccagagtgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctgctatttctgggatacagattaccaggaggggctctgcagcctgagtcaggaaggggcctccgtgaagatcatgggctacaaagattttgtatcttgttggaaaaactttgtgtacagtgatgatgagccattcaagccttggaagggactacaaaccaactttcgacttctgaaaagaaggctacgggagattctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 37 (glucose-6-phosphate transporter), member 4
- X-ray repair complementing defective repair in Chinese hamster cells 6
- amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
- apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C

Buy APOBEC3D-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D Gene now

Add to cart