Login to display prices
Login to display prices
XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene View larger

XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

Proteogenix catalog: PTXBC016314
Ncbi symbol: XRCC4
Product name: XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene
Size: 2ug
Accessions: BC016314
Gene id: 7518
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms: DNA repair protein XRCC4; SSMED; X-ray repair complementing defective repair in Chinese hamster cells 4; X-ray repair cross complementing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagaaaaataagcagaatccaccttgtttctgaacccagtataactcattttctacaagtatcttgggagaaaacactggaatctggttttgttattacacttactgatggtcattcagcatggactgggacagtttctgaatcagagatttcccaagaagctgatgacatggcaatggaaaaagggaaatatgttggtgaactgagaaaagcattgttgtcaggagcaggaccagctgatgtatacacgtttaatttttctaaagagtcttgttatttcttctttgagaaaaacctgaaagatgtctcattcagacttggttccttcaacctagagaaagttgaaaacccagctgaagtcattagagaacttatttgttattgcttggacaccattgcagaaaatcaagccaaaaatgagcacctgcagaaagaaaatgaaaggcttctgagagattggaatgatgttcaaggacgatttgaaaaatgtgtgagtgctaaggaagctttggagactgatctttataagcggtttattctggtgttgaatgagaagaaaacaaaaatcagaagtttgcataataaattattaaatgcagctcaagaacgagaaaaggacatcaaacaagaaggggaaactgcaatctgttctgaaatgactgctgaccgagatccagtctatgatgagagtactgatgaggaaagtgaaaaccaaactgatctctctgggttggcttcagctgctgtaagtaaagatgattccattatttcaagtcttgatgtcactgatattgcaccaagtagaaaaaggagacagcgaatgcaaagaaatcttgggacagaacctaaaatggctcctcaggagaatcagcttcaagaaaaggaaaattctaggcctgattcttcactacctgagacgtctaaaaaggagcacatctcagctgaaaacatgtctttagaaactctgagaaacagcagcccagaagacctctttgatgagatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: