XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene View larger

XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

PTXBC016314

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016314
Product type: DNA & cDNA
Ncbi symbol: XRCC4
Origin species: Human
Product name: XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene
Size: 2ug
Accessions: BC016314
Gene id: 7518
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms: DNA repair protein XRCC4; SSMED; X-ray repair complementing defective repair in Chinese hamster cells 4; X-ray repair cross complementing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagaaaaataagcagaatccaccttgtttctgaacccagtataactcattttctacaagtatcttgggagaaaacactggaatctggttttgttattacacttactgatggtcattcagcatggactgggacagtttctgaatcagagatttcccaagaagctgatgacatggcaatggaaaaagggaaatatgttggtgaactgagaaaagcattgttgtcaggagcaggaccagctgatgtatacacgtttaatttttctaaagagtcttgttatttcttctttgagaaaaacctgaaagatgtctcattcagacttggttccttcaacctagagaaagttgaaaacccagctgaagtcattagagaacttatttgttattgcttggacaccattgcagaaaatcaagccaaaaatgagcacctgcagaaagaaaatgaaaggcttctgagagattggaatgatgttcaaggacgatttgaaaaatgtgtgagtgctaaggaagctttggagactgatctttataagcggtttattctggtgttgaatgagaagaaaacaaaaatcagaagtttgcataataaattattaaatgcagctcaagaacgagaaaaggacatcaaacaagaaggggaaactgcaatctgttctgaaatgactgctgaccgagatccagtctatgatgagagtactgatgaggaaagtgaaaaccaaactgatctctctgggttggcttcagctgctgtaagtaaagatgattccattatttcaagtcttgatgtcactgatattgcaccaagtagaaaaaggagacagcgaatgcaaagaaatcttgggacagaacctaaaatggctcctcaggagaatcagcttcaagaaaaggaaaattctaggcctgattcttcactacctgagacgtctaaaaaggagcacatctcagctgaaaacatgtctttagaaactctgagaaacagcagcccagaagacctctttgatgagatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - X-ray repair complementing defective repair in Chinese hamster cells 3
- activating transcription factor 4 (tax-responsive enhancer element B67)
- activating transcription factor 4 (tax-responsive enhancer element B67)
- apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D

Buy XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene now

Add to cart