LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene View larger

LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene

PTXBC014040

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014040
Product type: DNA & cDNA
Ncbi symbol: LRFN4
Origin species: Human
Product name: LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene
Size: 2ug
Accessions: BC014040
Gene id: 78999
Gene description: leucine rich repeat and fibronectin type III domain containing 4
Synonyms: FIGLER6; SALM3; SALM3; leucine-rich repeat and fibronectin type-III domain-containing protein 4; fibronectin type III, immunoglobulin and leucine rich repeat domains 6; leucine rich repeat and fibronectin type III domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcactgggtcggtcctgacgaccggttggttggcaactcctcccgagcccgggctttccccaacgggaccttagagattggggtgaccggcgctggggacgctgggggctacacctgcatcgccaccaaccctgctggtgaggccacagcccgagtagaactgcgggtgctggccttgccccatggtgggaacagcagtgccgaggggggccgccccgggccctcggacatcgccgcctccgctcgcactgctgccgagggtgaggggacgctggagtctgagccagccgtgcaggtgacggaggtgaccgccacctcagggctggtgagctggggtcccgggcggccagccgacccagtgtggatgttccaaatccagtacaacagcagcgaagatgagaccctcatctaccggattgtcccagcctccagccaccacttcctgctgaagcacctcgtccccggcgctgactatgacctctgcctgctggccttgtcaccggccgctgggccctctgacctcacggccaccaggctgctgggctgtgcccatttctccacgctgccggcctcgcccctgtgccacgccctgcaggcccacgtgctgggcgggaccctgaccgtggccgtggggggtgtgctggtggctgccttactggtcttcactgtggccttgctggttcggggccggggggccggaaatggccgcctccccctcaagctcagccacgtccagtcccagaccaatggaggccccagccccacacccaaggcccacccgccgcggagccccccgccccggccgcagcgcagctgctctctggacctgggagatgccgggtgctacggttatgccaggcgcctgggaggagcttgggcccgacggagccactctgtgcatggggggctgctcggggcagggtgccggggggtaggaggcagcgccgagcggctggaagagagtgtggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ARP1 actin-related protein 1 homolog B, centractin beta (yeast)
- chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
- translocase of inner mitochondrial membrane 8 homolog B (yeast)
- translocase of inner mitochondrial membrane 8 homolog A (yeast)

Buy LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene now

Add to cart