YIPF2-Yip1 domain family, member 2 Gene View larger

YIPF2-Yip1 domain family, member 2 Gene

PTXBC013014

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIPF2-Yip1 domain family, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YIPF2-Yip1 domain family, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013014
Product type: DNA & cDNA
Ncbi symbol: YIPF2
Origin species: Human
Product name: YIPF2-Yip1 domain family, member 2 Gene
Size: 2ug
Accessions: BC013014
Gene id: 78992
Gene description: Yip1 domain family, member 2
Synonyms: protein YIPF2; FinGER2; YIP1 family member 2; Yip1 domain family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatcggccgacgagctgaccttccatgaattcgaggaggccactaatcttctggctgacaccccagatgcagccaccaccagcagaagcgatcagctgaccccacaagggcacgtggctgtggccgtgggctcaggtggcagctatggagccgaggatgaggtggaggaggagagtgacaaggccgcgctcctgcaggagcagcagcagcagcagcagccgggattctggaccttcagctactatcagagcttctttgacgtggacacctcacaggtcctggaccggatcaaaggctcactgctgccccggcctggccacaactttgtgcggcaccatctgcggaatcggccggatctgtatggccccttctggatctgtgccacgttggcctttgtcctggccgtcactggcaacctgacgctggtgctggcccagaggagggacccctccatccactacagcccccagttccacaaggtgaccgtggcaggcatcagcatctactgctatgcgtggctggtgcccctggccctgtggggcttcctgcggtggcgcaagggtgtccaggagcgcatggggccctacaccttcctggagactgtgtgcatctacggctactccctctttgtcttcatccccatggtggtcctgtggctcatccctgtgccttggctgcagtggctctttggggcgctggccctgggcctgtcagccgccgggctggtattcaccctctggcccgtggtccgtgaggacaccaggctggtggccacagtgctgctgtccgtggtcgtgctgctccacgccctcctggccatgggctgtaagttgtacttcttccagtcgctgcctccggagaacgtggctcctcctccccaaatcacatctctgccctcaaacatcgcgctgtcccctaccttgccgcagtccctggccccctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein, large, P0
- lymphocyte-specific protein 1
- stromal cell derived factor 4
- histocompatibility (minor) 13

Buy YIPF2-Yip1 domain family, member 2 Gene now

Add to cart