HM13-histocompatibility (minor) 13 Gene View larger

HM13-histocompatibility (minor) 13 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HM13-histocompatibility (minor) 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HM13-histocompatibility (minor) 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008938
Product type: DNA & cDNA
Ncbi symbol: HM13
Origin species: Human
Product name: HM13-histocompatibility (minor) 13 Gene
Size: 2ug
Accessions: BC008938
Gene id: 81502
Gene description: histocompatibility (minor) 13
Synonyms: H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1; minor histocompatibility antigen H13; intramembrane protease 1; minor histocompatibility antigen 13; presenilin-like protein 3; signal peptide peptidase beta; signal peptide peptidase like 1; histocompatibility minor 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcggccctcagcgatccgcataacggcagtgccgaggcaggcggccccaccaacagcactacgcggccgccttccacgcccgagggcatcgcgctggcctacggcagcctcctgctcatggcgctgctgcccatcttcttcggcgccctgcgctccgtacgctgcgcccgcggcaagaatgcttcagacatgcctgaaacaatcaccagccgggatgccgcccgcttccccatcatcgccagctgcacactcttggggctctacctctttttcaaaatattctcccaggagtacatcaacctcctgctgtccatgtatttcttcgtgctgggaatcctggccctgtcccacaccatcagccccttcatgaataagttttttccagccagctttccaaatcgacagtaccagctgctcttcacacagggttctggggaaaacaaggaagagatcatcaattatgaatttgacaccaaggacctggtgtgcctgggcctgagcagcatcgttggcgtctggtacctgctgaggaagcactggattgccaacaacctttttggcctggccttctcccttaatggagtagagctcctgcacctcaacaatgtcagcactggctgcatcctgctgggcggactcttcatctacgatgtcttctgggtatttggcaccaatgtgatggtgacagtggccaagttcttcgaggcaccaataaaattggtgtttccccaggatctgctggagaaaggcctcgaagcaaacaactttgccatgctgggacttggagatgtcgtcattccagggatcttcattgccttgctgctgcgctttgacatcagcttgaagaagaatacccacacctacttctacaccagctttgcagcctacatcttcggcctgggccttaccatcttcatcatgcacatcttcaagcatgctcagcctgccctcctatacctggtccccgcctgcatcggttttcctgtcctggtggcgctggccaagggagaagtgacagagatgttcagttatgaggagtcaaatcctaaggatccagcggcagtgacagaatccaaagagggaacagaggcatcagcatcgaaggggctggagaagaaagagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FIP1 like 1 (S. cerevisiae)
- LUC7-like 2 (S. cerevisiae)
- N-myc downstream regulated 1
- RNA binding motif protein 17

Buy HM13-histocompatibility (minor) 13 Gene now

Add to cart