LUC7L2-LUC7-like 2 (S. cerevisiae) Gene View larger

LUC7L2-LUC7-like 2 (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LUC7L2-LUC7-like 2 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LUC7L2-LUC7-like 2 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017163
Product type: DNA & cDNA
Ncbi symbol: LUC7L2
Origin species: Human
Product name: LUC7L2-LUC7-like 2 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017163
Gene id: 51631
Gene description: LUC7-like 2 (S. cerevisiae)
Synonyms: CGI-59; CGI-74; LUC7B2; LUC7-like 2; LUC7 like 2, pre-mRNA splicing factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggcgcaggcccagatgcgcgcgatgctggaccagttgatgggcacctcccgggacggagatacaactcgtcaacgaatcaaattcagtgatgacagagtatgcaagagtcaccttctcaactgttgtcctcatgatgtcctttctggaactagaatggatcttggagaatgtctgaaagtccatgacctggctttaagagcggattatgaaattgcatccaaagaacaagattttttctttgaacttgatgccatggatcatctgcagtcattcattgcagattgtgatcgtagaacagaagtggccaagaaaagattagcagaaactcaagaagagattagtgctgaagtagcagcaaaggcagaacgtgttcatgagttaaatgaagaaattggtaaattgttagccaaggtggaacaactaggagctgaagggaatgtggaggaatcccagaaagtaatggatgaagtagagaaagcacgggcaaagaaaagagaagcagaggaagtttatcggaattctatgccagcttccagttttcagcagcagaaacttcgagtctgtgaagtctgctctgcctatttaggacttcatgataatgacagacgactggctgatcattttgggggtaaactgcacctgggatttattgaaataagagagaagcttgaagaattaaagagagtcgtagctgagaagcaggagaaaagaaaccaggaacggctgaaacgaagagaagagagagagagagaagaaagggagaagctgaggaggtcccgatcacacagcaagaatccaaaaagatccaggtccagagagcatcgcagacatcgatctcgctccatgtcacgtgaacgcaagaggagaactcgatccaaatctcgggagaaacgccatcgccacaggtcccgctccagcagccgtagccgcagccgtagccaccagagaagtcggcacagttctagagataggagcagagaacgatccaagaggagatcctcaaaagaaagattcagagaccaagacttagcatcatgtgacagagacaggagttcaagagacagatcacctcgtgacagagatcggaaagataagaagcggtcctatgagagtgctaatggcagatcagaagacaggaggagctctgaagagcgcgaagcaggggagatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-myc downstream regulated 1
- RNA binding motif protein 17
- actin binding LIM protein 1
- RNA binding motif protein 22

Buy LUC7L2-LUC7-like 2 (S. cerevisiae) Gene now

Add to cart