Login to display prices
Login to display prices
NDRG1-N-myc downstream regulated 1 Gene View larger

NDRG1-N-myc downstream regulated 1 Gene

PTXBC003175

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDRG1-N-myc downstream regulated 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDRG1-N-myc downstream regulated 1 Gene

Proteogenix catalog: PTXBC003175
Ncbi symbol: NDRG1
Product name: NDRG1-N-myc downstream regulated 1 Gene
Size: 2ug
Accessions: BC003175
Gene id: 10397
Gene description: N-myc downstream regulated 1
Synonyms: protein NDRG1; CAP43; CMT4D; DRG-1; DRG1; GC4; HMSNL; NDR1; NMSL; PROXY1; RIT42; RTP; TARG1; TDD5; N-myc downstream-regulated gene 1 protein; differentiation-related gene 1 protein; nickel-specific induction protein Cap43; protein regulated by oxygen-1; reducing agents and tunicamycin-responsive protein; N-myc downstream regulated 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggagaccatcaccggcctcctgcaagagtttgatgtccaggagcaggacatcgagactttacatggctctgttcacgtcacgctgtgtgggactcccaagggaaaccggcctgtcatcctcacctaccatgacatcggcatgaaccacaaaacctgctacaaccccctcttcaactacgaggacatgcaggagatcacccagcactttgccgtctgccacgtggacgcccctggccagcaggacggcgcagcctccttccccgcagggtacatgtacccctccatggatcagctggctgaaatgcttcctggagtccttcaacagtttgggctgaaaagcattattggcatgggaacaggagcaggcgcctacatcctaactcgatttgctctaaacaaccctgagatggtggagggccttgtccttatcaacgtgaacccttgtgcggaaggctggatggactgggccgcctccaagatctcaggatggacccaagctctgccggacatggtggtgtcccacctttttgggaaggaagaaatgcagagtaacgtggaagtggtccacacctaccgccagcacattgtgaatgacatgaaccccggcaacctgcacctgttcatcaatgcctacaacagccggcgcgacctggagattgagcgaccaatgccgggaacccacacagtcaccctgcagtgccctgctctgttggtggttggggacagctcgcctgcagtggatgccgtggtggagtgcaactcaaaattggacccaacaaagaccactctcctcaagatggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctcccacaccagcgagggcacccgaagccgctcccacaccagcgagggcacccgcagccgctcgcacaccagcgagggggcccacctggacatcacccccaactcgggtgctgctgggaacagcgccgggcccaagtccatggaggtctcctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: