RPLP0-ribosomal protein, large, P0 Gene View larger

RPLP0-ribosomal protein, large, P0 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPLP0-ribosomal protein, large, P0 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPLP0-ribosomal protein, large, P0 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000345
Product type: DNA & cDNA
Ncbi symbol: RPLP0
Origin species: Human
Product name: RPLP0-ribosomal protein, large, P0 Gene
Size: 2ug
Accessions: BC000345
Gene id: 6175
Gene description: ribosomal protein, large, P0
Synonyms: L10E; LP0; PRLP0; RPP0; 60S acidic ribosomal protein P0; 60S ribosomal protein L10E; acidic ribosomal phosphoprotein P0; neutral ribosomal phosphoprotein P0; ribosomal protein, large, P0; ribosomal protein lateral stalk subunit P0
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccagggaagacagggcgacctggaagtccaactacttccttaagatcatccaactattggatgattatccgaaatgtttcattgtgggagcagacaatgtgggctccaagcagatgcagcagatccgcatgtcccttcgtgggaaggctgtggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lymphocyte-specific protein 1
- stromal cell derived factor 4
- histocompatibility (minor) 13
- FIP1 like 1 (S. cerevisiae)

Buy RPLP0-ribosomal protein, large, P0 Gene now

Add to cart