LSP1-lymphocyte-specific protein 1 Gene View larger

LSP1-lymphocyte-specific protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSP1-lymphocyte-specific protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSP1-lymphocyte-specific protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001785
Product type: DNA & cDNA
Ncbi symbol: LSP1
Origin species: Human
Product name: LSP1-lymphocyte-specific protein 1 Gene
Size: 2ug
Accessions: BC001785
Gene id: 4046
Gene description: lymphocyte-specific protein 1
Synonyms: WP34; pp52; lymphocyte-specific protein 1; 47 kDa actin binding protein; 52 kDa phosphoprotein; F-actin binding and cytoskeleton associated protein; leufactin (leukocyte F-actin binding protein); leukocyte-specific protein 1; lymphocyte-specific antigen WP34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaggcttcgagtgacccgggtgctgaggagcgggaagagttgctggggcccactgctcagtggagcgtggaggacgaggaggaggccgtccacgagcaatgccagcatgagagagacaggcagcttcaggcccaggacgaggagggaggcggccatgtccccgagcggccgaagcaggagatgctcctcagcctgaagccctcggaggcccctgaactggatgaggacgagggctttggcgactggtcccagaggccagagcagcggcagcagcacgagggggcgcagggcaccttggacagcggagagcccccccagtgcaggagtcctgagggggagcaagaggacaggcccggcctgcatgcctacgaaaaggaggacagtgatgaagtccacctggaggagttgagtctgagcaaggaggggccaggcccagaggacactgtccaggacaacctgggggccgcaggggctgaggaggaacaggaggagcaccagaaatgtcagcagcccaggacacccagccccttggtcttggaggggaccatcgaacagagctcgcctcccctgagccctaccaccaaactcatcgacaggaccgagtccctaaaccgctccatagagaagagtaacagtgtgaagaaatcccagccagacttgcccatctccaagattgatcagtggctggaacaatacacccaggccatcgagaccgctggccggacccccaagctagcccgccaggcctccatagagctgcccagcatggctgtggccagtaccaagagtcggtgggagacgggtgaggtacaggctcagtctgcggccaagactccgtcctgcaaggatattgtggctggagacatgagcaagaaaagcctctgggagcagaagggaggctccaagacctcatcaacaattaagagcaccccatctgggaagaggtataagtttgtggccaccgggcatgggaagtatgagaaggtgcttgtggaagggggcccggctccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stromal cell derived factor 4
- histocompatibility (minor) 13
- FIP1 like 1 (S. cerevisiae)
- LUC7-like 2 (S. cerevisiae)

Buy LSP1-lymphocyte-specific protein 1 Gene now

Add to cart