Login to display prices
Login to display prices
RBM11-RNA binding motif protein 11 Gene View larger

RBM11-RNA binding motif protein 11 Gene

PTXBC030196

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM11-RNA binding motif protein 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBM11-RNA binding motif protein 11 Gene

Proteogenix catalog: PTXBC030196
Ncbi symbol: RBM11
Product name: RBM11-RNA binding motif protein 11 Gene
Size: 2ug
Accessions: BC030196
Gene id: 54033
Gene description: RNA binding motif protein 11
Synonyms: splicing regulator RBM11; RNA binding motif protein 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccctgctcaggaggaggccgacaggaccgtgtttgttgggaatttagaggcccgagttcgggaagagattctgtacgagctgttccttcaggcggggccactaaccaaagtgactatatgcaaagacagagaaggaaagccaaagtcttttggatttgtctgctttaaacacccagaatcggtgtcttatgccatagctttgctgaatggaattcgtttatatggaagaccaattaacgtgcagtatcgatttgggagttctcgctcttctgaaccagctaaccaaagttttgagagctgtgttaagataaattcacacaactacaggaatgaagaaatgttggtgggcagatcttcctttcccatgcagtattttccaattaataatacttctttacctcaagaatattttctctttcagaagatgcagtggcatgtgtataatccagtgctgcagcttccttactatgaaatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgaataaacgaaagagacaaaagcaaacaagtgatagtgatagtagcacagacaacaacagaggcaacgaatgtagccaaaagttccgaaagtctaagaagaagaaaagatactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: