RBM11-RNA binding motif protein 11 Gene View larger

RBM11-RNA binding motif protein 11 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM11-RNA binding motif protein 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBM11-RNA binding motif protein 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030196
Product type: DNA & cDNA
Ncbi symbol: RBM11
Origin species: Human
Product name: RBM11-RNA binding motif protein 11 Gene
Size: 2ug
Accessions: BC030196
Gene id: 54033
Gene description: RNA binding motif protein 11
Synonyms: splicing regulator RBM11; RNA binding motif protein 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccctgctcaggaggaggccgacaggaccgtgtttgttgggaatttagaggcccgagttcgggaagagattctgtacgagctgttccttcaggcggggccactaaccaaagtgactatatgcaaagacagagaaggaaagccaaagtcttttggatttgtctgctttaaacacccagaatcggtgtcttatgccatagctttgctgaatggaattcgtttatatggaagaccaattaacgtgcagtatcgatttgggagttctcgctcttctgaaccagctaaccaaagttttgagagctgtgttaagataaattcacacaactacaggaatgaagaaatgttggtgggcagatcttcctttcccatgcagtattttccaattaataatacttctttacctcaagaatattttctctttcagaagatgcagtggcatgtgtataatccagtgctgcagcttccttactatgaaatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgaataaacgaaagagacaaaagcaaacaagtgatagtgatagtagcacagacaacaacagaggcaacgaatgtagccaaaagttccgaaagtctaagaagaagaaaagatactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Yip1 domain family, member 2
- ribosomal protein, large, P0
- lymphocyte-specific protein 1
- stromal cell derived factor 4

Buy RBM11-RNA binding motif protein 11 Gene now

Add to cart