Login to display prices
Login to display prices
SNAI1-snail homolog 1 (Drosophila) Gene View larger

SNAI1-snail homolog 1 (Drosophila) Gene

PTXBC012910

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAI1-snail homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNAI1-snail homolog 1 (Drosophila) Gene

Proteogenix catalog: PTXBC012910
Ncbi symbol: SNAI1
Product name: SNAI1-snail homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC012910
Gene id: 6615
Gene description: snail homolog 1 (Drosophila)
Synonyms: zinc finger protein SNAI1; SLUGH2; SNA; SNAH; SNAIL; SNAIL1; dJ710H13.1; protein sna; protein snail homolog 1; snail 1 homolog; snail 1 zinc finger protein; snail family zinc finger 1; snail homolog 1; snail family transcriptional repressor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagcgagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctgctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatctgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccaggagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcccagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttccttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcccagctctctgaggccaaggatctccaggctcgaaaggccttcaactgcaaatactgcaacaaggaatacctcagcctgggtgccctcaagatgcacatccgaagccacacgctgccctgcgtctgcggaacctgcgggaaggccttctctaggccctggctgctacaaggccatgtccggacccacactggcgagaagcccttctcctgtccccactgcagccgtgccttcgctgaccgctccaacctgcgggcccacctccagacccactcagatgtcaagaagtaccagtgccaggcgtgtgctcggaccttctcccgaatgtccctgctccacaagcaccaagagtccggctgctcaggatgtccccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: