CLDND1-claudin domain containing 1 Gene View larger

CLDND1-claudin domain containing 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDND1-claudin domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CLDND1-claudin domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001757
Product type: DNA & cDNA
Ncbi symbol: CLDND1
Origin species: Human
Product name: CLDND1-claudin domain containing 1 Gene
Size: 2ug
Accessions: BC001757
Gene id: 56650
Gene description: claudin domain containing 1
Synonyms: C3orf4; GENX-3745; claudin domain-containing protein 1; claudin domain containing 1 protein; membrane protein GENX-3745; claudin domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataaccgttttgctacagcatttgtaattgcttgtgtgcttagcctcatttccaccatctacatggcagcctccattggcacagacttctggtatgaatatcgaagtccagttcaagaaaattccagtgatttgaataaaagcatctgggatgaattcattagtgatgaggcagatgaaaagacttataatgatgcactttttcgatacaatggcacagtgggattgtggagacggtgtatcaccatacccaaaaacatgcattggtatagcccaccagaaaggacagagtcatttgatgtggtcacaaaatgtgtgagtttcacactaactgagcagttcatggagaaatttgttgatcccggaaaccacaatagcgggattgatctccttaggacctatctttggcgttgccagttccttttaccttttgtgagtttaggtttgatgtgctttggggctttgatcggactttgtgcttgcatttgccgaagcttatatcccaccattgccacgggcattctccatctccttgcaggtctgtgtacactgggctcagtaagttgttatgttgctggaattgaactactccaccagaaactagagctccctgacaatgtatccggtgaatttggatggtccttctgcctggcttgtgtctctgctcccttacagttcatggcttctgctctcttcatctgggctgctcacaccaaccggaaagagtacaccttaatgaaggcatatcgtgtggcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - snail homolog 1 (Drosophila)
- integral membrane protein 2B
- RNA binding motif protein 11
- Yip1 domain family, member 2

Buy CLDND1-claudin domain containing 1 Gene now

Add to cart