NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene View larger

NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032797
Product type: DNA & cDNA
Ncbi symbol: NSMCE2
Origin species: Human
Product name: NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC032797
Gene id: 286053
Gene description: non-SMC element 2, MMS21 homolog (S. cerevisiae)
Synonyms: C8orf36; MMS21; ZMIZ7; E3 SUMO-protein ligase NSE2; MMS21 homolog; hMMS21; methyl methanesulfonate sensitivity gene 21; non-SMC element 2 homolog; non-SMC element 2, MMS21 homolog; non-structural maintenance of chromosomes element 2 homolog; zinc finger, MIZ-type containing 7; NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggacgttccagttcaaattcaggttcaactggtttcatctccttcagtggtgtagagtctgctctctcctccttgaaaaacttccaagcctgtatcaactctggtatggacacagcttctagtgttgctttggatcttgtggaaagtcagactgaagtgagtagtgaatatagtatggacaaggcaatggttgaatttgctacattggatcggcaactaaaccattatgtaaaggctgttcaatctacaataaatcatgtgaaagaagaacgtccagaaaaaataccagatttaaaattattggtagagaagaaatttttggctttacagagcaagaattctgatgcagactttcaaaataatgaaaaatttgtacagtttaaacaacagctgaaagaactaaagaagcaatgtggtcttcaagctgacagagaagctgacggaacagaaggagtggatgaagatataattgtgacccaaagtcagaccaacttcacctgccccattacaaaggaggaaatgaagaagccagtgaaaaataaagtgtgtggccacacctatgaagaggacgccattgttcgcatgattgagtccaggcaaaagcggaagaaaaaggcctattgccctcaaattggctgtagccacacggatataagaaagtcagatcttatccaggatgaagcacttagaagggcaattgagaaccataacaagaaaagacatcgtcattccgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP glycosyltransferase 3 family, polypeptide A1
- non imprinted in Prader-Willi/Angelman syndrome 1
- pseudouridylate synthase 7 homolog (S. cerevisiae)
- family with sequence similarity 108, member A1

Buy NSMCE2-non-SMC element 2, MMS21 homolog (S. cerevisiae) Gene now

Add to cart