NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene View larger

NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene

PTXBC025678

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025678
Product type: DNA & cDNA
Ncbi symbol: NIPA1
Origin species: Human
Product name: NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene
Size: 2ug
Accessions: BC025678
Gene id: 123606
Gene description: non imprinted in Prader-Willi/Angelman syndrome 1
Synonyms: magnesium transporter NIPA1; FSP3; SPG6; non-imprinted in Prader-Willi/Angelman syndrome region protein 1; spastic paraplegia 6 protein; non imprinted in Prader-Willi/Angelman syndrome 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgtcgtgctgattatccactccccaaagtctgagagtgtgacaactcaggctgagctggaggaaaagctgaccaatccagtgtttgtgggctacctgtgcatcgtgctgctcatgctgctgctgctcatcttctggatcgcgccggcccatgggcccaccaacatcatggtctacatcagcatctgctccttgctgggcagtttcaccgtgccttccaccaagggcatcgggctggcggcccaagacatcttgcataacaacccgtccagtcagagagccctctgcctgtgcctggtactcctggccgtgctcggctgcagcatcatcgtccagttcaggtacatcaacaaggcgctggagtgcttcgactcctcggtgttcggggccatctactacgtcgtgtttaccacgctggtcctgctggcctcagccatcctcttccgggagtggagcaacgtgggcctggtggacttcttggggatggcctgtggattcacgaccgtctccgtggggattgtccttatacaggtgttcaaagagttcaatttcaaccttggggagatgaacaaatctaatatgaaaacagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pseudouridylate synthase 7 homolog (S. cerevisiae)
- family with sequence similarity 108, member A1
- retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
- retinol dehydrogenase 11 (all-trans/9-cis/11-cis)

Buy NIPA1-non imprinted in Prader-Willi/Angelman syndrome 1 Gene now

Add to cart