FAM108A1-family with sequence similarity 108, member A1 Gene View larger

FAM108A1-family with sequence similarity 108, member A1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM108A1-family with sequence similarity 108, member A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM108A1-family with sequence similarity 108, member A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009256
Product type: DNA & cDNA
Ncbi symbol: FAM108A1
Origin species: Human
Product name: FAM108A1-family with sequence similarity 108, member A1 Gene
Size: 2ug
Accessions: BC009256
Gene id: 81926
Gene description: family with sequence similarity 108, member A1
Synonyms: 1700013O15Rik; BC005632; D10Bwg1364e; Fam108a; protein ABHD17A; abhydrolase domain-containing protein 17A; abhydrolase domain-containing protein FAM108A; alpha/beta hydrolase domain-containing protein 17A; family with sequence similarity 108, member A; mFLJ00358 protein; abhydrolase domain containing 17A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgggctgtcgctgagtgagctctgctgcctcttctgctgcccgccctgccccggccgcatcgctgccaagctcgccttcctgccgccggaggccacctactccctggtgcctgagcccgagccggggcctggtggggccggggccgcccccttggggaccctgagagcctcctcgggcgcacccgggcgctggaagctgcacctgacggagcgtgccgacttccagtacagccagcgcgagctggacaccatcgaggtcttccccaccaagagcgcccgcggcaaccgcgtctcctgcatgtatgttcgctgcgtgcctggtgccaggtacacggtcctcttctcgcacggcaatgccgtggacctgggccagatgagcagcttctacattggcctgggctcccgcctccactgcaacatcttctcctacgactactccggctacggtgccagctcgggcaggccttccgagaggaacctctatgccgacatcgacgccgcctggcaggccctgcgcaccaggtacggcatcagcccggacagcatcatcctgtacgggcagagcatcggcacggtgcccaccgtggacctggcctcgcgctacgagtgtgccgcggtggtgctgcactcgccgctcacctcgggcatgcgcgtcgccttccccgacaccaagaagacctactgcttcgacgccttccctaacatcgagaaggtgtccaagatcacgtctcccgtgctcatcatccacggcacggaggacgaggtgatcgacttctcgcacgggctggcgctctacgagcgctgccccaaggcggtggagccgctgtgggtggagggcgccgggcacaacgacatcgagctctacagccagtacctggagcgcctgcgtcgcttcatctcccaggagctgcccagccagcgcgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
- retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
- retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
- DNA fragmentation factor, 45kDa, alpha polypeptide

Buy FAM108A1-family with sequence similarity 108, member A1 Gene now

Add to cart