Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FAM108A1-family with sequence similarity 108, member A1 Gene
PTXBC009256
New product
Data sheet of FAM108A1-family with sequence similarity 108, member A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM108A1-family with sequence similarity 108, member A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009256 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM108A1 |
| Origin species: | Human |
| Product name: | FAM108A1-family with sequence similarity 108, member A1 Gene |
| Size: | 2ug |
| Accessions: | BC009256 |
| Gene id: | 81926 |
| Gene description: | family with sequence similarity 108, member A1 |
| Synonyms: | 1700013O15Rik; BC005632; D10Bwg1364e; Fam108a; protein ABHD17A; abhydrolase domain-containing protein 17A; abhydrolase domain-containing protein FAM108A; alpha/beta hydrolase domain-containing protein 17A; family with sequence similarity 108, member A; mFLJ00358 protein; abhydrolase domain containing 17A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgggctgtcgctgagtgagctctgctgcctcttctgctgcccgccctgccccggccgcatcgctgccaagctcgccttcctgccgccggaggccacctactccctggtgcctgagcccgagccggggcctggtggggccggggccgcccccttggggaccctgagagcctcctcgggcgcacccgggcgctggaagctgcacctgacggagcgtgccgacttccagtacagccagcgcgagctggacaccatcgaggtcttccccaccaagagcgcccgcggcaaccgcgtctcctgcatgtatgttcgctgcgtgcctggtgccaggtacacggtcctcttctcgcacggcaatgccgtggacctgggccagatgagcagcttctacattggcctgggctcccgcctccactgcaacatcttctcctacgactactccggctacggtgccagctcgggcaggccttccgagaggaacctctatgccgacatcgacgccgcctggcaggccctgcgcaccaggtacggcatcagcccggacagcatcatcctgtacgggcagagcatcggcacggtgcccaccgtggacctggcctcgcgctacgagtgtgccgcggtggtgctgcactcgccgctcacctcgggcatgcgcgtcgccttccccgacaccaagaagacctactgcttcgacgccttccctaacatcgagaaggtgtccaagatcacgtctcccgtgctcatcatccacggcacggaggacgaggtgatcgacttctcgcacgggctggcgctctacgagcgctgccccaaggcggtggagccgctgtgggtggagggcgccgggcacaacgacatcgagctctacagccagtacctggagcgcctgcgtcgcttcatctcccaggagctgcccagccagcgcgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - retinol dehydrogenase 12 (all-trans/9-cis/11-cis) - retinol dehydrogenase 11 (all-trans/9-cis/11-cis) - retinol dehydrogenase 11 (all-trans/9-cis/11-cis) - DNA fragmentation factor, 45kDa, alpha polypeptide |