DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene View larger

DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007721
Product type: DNA & cDNA
Ncbi symbol: DFFA
Origin species: Human
Product name: DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene
Size: 2ug
Accessions: BC007721
Gene id: 1676
Gene description: DNA fragmentation factor, 45kDa, alpha polypeptide
Synonyms: DFF-45; DFF1; ICAD; DNA fragmentation factor subunit alpha; DNA fragmentation factor 45 kDa subunit; DNA fragmentation factor, 45kDa, alpha polypeptide; inhibitor of CAD
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtgaccggggacgccggggtaccagaatctggcgagatccggactctaaagccgtgtctgctgcgccgcaactacagccgcgaacagcacggcgtggccgcctcctgcctcgaagacctgaggagcaaggcctgtgacattctggccattgataagtccctgacaccagtcaccctggtcctggcagaggatggcaccatagtggatgatgacgattactttctgtgtctaccttccaatactaagtttgtggcattggctagtaatgagaaatgggcatacaacaattcagatggaggtacagcttggatttcccaagagtcctttgatgtagatgaaacagacagcggggcagggttgaagtggaagaatgtggccaggcagctgaaagaagatctgtccagcatcatcctcctatcagaggaggacctccagatgcttgttgacgctccctgctcagacctggctcaggaactacgtcagagttgtgccaccgtccagcggctgcagcacacactccaacaggtgcttgaccaaagagaggaagtgcgtcagtccaagcagctcctgcagctgtacctccaggctttggagaaagagggcagcctcttgtcaaagcaggaagagtccaaagctgcctttggtgaggaggtggatgcagtagacacgggtatcagcagagagacctcctcggacgttgcgctggcgagccacatccttactgcactgagggagaagcaggctccagagctgagcttatctagtcaggatttggagttggttaccaaggaagaccccaaagcactggctgttgccttgaactgggacataaagaagacggagactgttcaggaggcctgtgagtgggagctcgccctgcgcctgcagcagacgcagagcttgcattctctccggagcatctcagcaagcaaggcctcaccacctggtgacctgcagaatcctaagcgagccagacaggatcccacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2Q family member 2
- chromobox homolog 8 (Pc class homolog, Drosophila)
- protein tyrosine phosphatase, non-receptor type 7
- ectonucleoside triphosphate diphosphohydrolase 5

Buy DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene now

Add to cart