Login to display prices
Login to display prices
DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene View larger

DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene

PTXBC007721

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene

Proteogenix catalog: PTXBC007721
Ncbi symbol: DFFA
Product name: DFFA-DNA fragmentation factor, 45kDa, alpha polypeptide Gene
Size: 2ug
Accessions: BC007721
Gene id: 1676
Gene description: DNA fragmentation factor, 45kDa, alpha polypeptide
Synonyms: DFF-45; DFF1; ICAD; DNA fragmentation factor subunit alpha; DNA fragmentation factor 45 kDa subunit; DNA fragmentation factor, 45kDa, alpha polypeptide; inhibitor of CAD
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtgaccggggacgccggggtaccagaatctggcgagatccggactctaaagccgtgtctgctgcgccgcaactacagccgcgaacagcacggcgtggccgcctcctgcctcgaagacctgaggagcaaggcctgtgacattctggccattgataagtccctgacaccagtcaccctggtcctggcagaggatggcaccatagtggatgatgacgattactttctgtgtctaccttccaatactaagtttgtggcattggctagtaatgagaaatgggcatacaacaattcagatggaggtacagcttggatttcccaagagtcctttgatgtagatgaaacagacagcggggcagggttgaagtggaagaatgtggccaggcagctgaaagaagatctgtccagcatcatcctcctatcagaggaggacctccagatgcttgttgacgctccctgctcagacctggctcaggaactacgtcagagttgtgccaccgtccagcggctgcagcacacactccaacaggtgcttgaccaaagagaggaagtgcgtcagtccaagcagctcctgcagctgtacctccaggctttggagaaagagggcagcctcttgtcaaagcaggaagagtccaaagctgcctttggtgaggaggtggatgcagtagacacgggtatcagcagagagacctcctcggacgttgcgctggcgagccacatccttactgcactgagggagaagcaggctccagagctgagcttatctagtcaggatttggagttggttaccaaggaagaccccaaagcactggctgttgccttgaactgggacataaagaagacggagactgttcaggaggcctgtgagtgggagctcgccctgcgcctgcagcagacgcagagcttgcattctctccggagcatctcagcaagcaaggcctcaccacctggtgacctgcagaatcctaagcgagccagacaggatcccacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: