UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene View larger

UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017708
Product type: DNA & cDNA
Ncbi symbol: UBE2Q2
Origin species: Human
Product name: UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene
Size: 2ug
Accessions: BC017708
Gene id: 92912
Gene description: ubiquitin-conjugating enzyme E2Q family member 2
Synonyms: ubiquitin-conjugating enzyme E2 Q2; E2 ubiquitin-conjugating enzyme Q2; ubiquitin carrier protein Q2; ubiquitin conjugating enzyme E2Q family member 2; ubiquitin-protein ligase Q2; ubiquitin conjugating enzyme E2 Q2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgtgtcagggctcaaggccgagctgaagttcctggcgtccatcttcgacaagaaccacgagcgattccgcatcgtcagttggaagctggacgagctgcactgccagttcctggtgccgcagcagggcagcccgcactcgctgccgccgccactcacgctccactgcaacatcacggaatcctatccatcttcttcaccgatatggtttgtggattctgaagacccaaatctgacatcagttctggaacgtctagaagatactaagaacaacaatttgcttcgtcagcaattgaagtggttgatatgtgaactctgcagtttatataaccttcctaagcacctggatgttgagatgctagatcaaccactacccacgggtcagaatgggacaacagaagaagtgacttcagaagaagaggaagaagaagaagagatggctgaagatatagaagacttagatcactatgagatgaaggaagaagagcctattagtgggaaaaagtcagaggatgaaggaattgaaaaagaaaatttggcaatattagagaaaattaggaagactcaaaggcaagaccatttaaatggtgcagtgtctgggtcagtgcaagcttcagatagacttatgaaagagctcagggacatatacagatcacagagttataaaacagggatttattcagtggaactcataaatgacagtttatatgactggcatgttaaactgcagaaggttgaccctgatagtcctttgcacagtgatcttcagatcttaaaagaaaaagaaggcatagaatatattttgcttaacttctcttttaaggataactttccatttgatcctccatttgttcgagtggtgttacctgttctctcaggagggtatgtattgggtggaggagcattatgtatggaacttctcacaaaacagggctggagcagtgcctactcaatagaatcggtcatcatgcaaataaatgccaccttagtcaaaggcaaagccagagtgcagtttggagcaaataagaatcaatataatctagcaagagcccaacaatcctataattccattgtacagatacatgagaaaaatggctggtacacccctccaaaggaagatggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromobox homolog 8 (Pc class homolog, Drosophila)
- protein tyrosine phosphatase, non-receptor type 7
- ectonucleoside triphosphate diphosphohydrolase 5
- actin-related protein 10 homolog (S. cerevisiae)

Buy UBE2Q2-ubiquitin-conjugating enzyme E2Q family member 2 Gene now

Add to cart