ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene View larger

ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011997
Product type: DNA & cDNA
Ncbi symbol: ACTR10
Origin species: Human
Product name: ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011997
Gene id: 55860
Gene description: actin-related protein 10 homolog (S. cerevisiae)
Synonyms: ACTR11; Arp10; Arp11; HARP11; actin-related protein 10; actin-related protein 11; actin-related protein 10 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctctacgagggcctggggagcggcggggagaagacggcggtcgtgatcgacctgggagaggcctttaccaagtgtggatttgctggagaaactggtccaagatgtataattcctagtgtgataaaaagagctgggatgcctaagcctgtcagagttgttcagtataatatcaatacagaagaattatattcctacctaaaggaattcatccacatactatatttcaggcatctattggtgaatcccagagaccgccgagttgtgattatcgaatcggtattatgtccttctcacttcagagagacactcactcgtgttcttttcaaatattttgaggttccatctgtcttgcttgctccaagtcatctaatggctcttctgacgcttggaattaattctgccatggtcctagattgtggatatagggaaagcctggtgttacccatatatgaaggaatcccagttctaaattgttggggagcactacccctaggaggaaaagctcttcacaaagagttggaaactcaactattggaacaatgtactgttgacacaagtgttgctaaagaacagagccttccctcagtgatgggttcagttccggaaggtgtcttagaggacattaaagcgcgtacttgctttgtaagtgatctgaagcgaggactaaaaatccaagcagcaaaatttaatattgatgggaataatgagcgtccctccccacccccaaatgttgactatccattagatggagagaagattttacatatccttggatcaatcagagattcagttgtggaaattctttttgaacaagataatgaagagcaatcagttgccactttaatattggattcccttatacagtgtccgatagacaccaggaagcaactagcagagaatttggtagtcataggtggcacttctatgttgccaggatttctccacagattgcttgcagaaataaggtatttggtagaaaaaccaaaatataaaaaagcacttggcactaagacatttcgaattcatactccacctgcaaaagctaattgtgtggcctggttgggaggggctatttttggagcattacaagatatacttgggagccgttctgtttcaaaggaatattataatcagacgggccgtatacctgattggtgttctctcaataacccacctttggaaatgatgtttgatgtcgggaaaactcaaccacctctgatgaagagagcattttccactgagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fumarylacetoacetate hydrolase (fumarylacetoacetase)
- serine/threonine kinase 25 (STE20 homolog, yeast)
- glucosaminyl (N-acetyl) transferase 3, mucin type
- ribosomal RNA processing 1 homolog (S. cerevisiae)

Buy ACTR10-actin-related protein 10 homolog (S. cerevisiae) Gene now

Add to cart