RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene View larger

RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037302
Product type: DNA & cDNA
Ncbi symbol: RDH11
Origin species: Human
Product name: RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene
Size: 2ug
Accessions: BC037302
Gene id: 51109
Gene description: retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Synonyms: ARSDR1; CGI82; HCBP12; MDT1; PSDR1; RALR1; RDJCSS; SCALD; SDR7C1; retinol dehydrogenase 11; HCV core-binding protein HCBP12; androgen-regulated short-chain dehydrogenase/reductase 1; prostate short-chain dehydrogenase reductase 1; retinal reductase 1; short chain dehydrogenase/reductase family 7C, member 1; retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgagctcatgttcccgctgttgctcctccttctgcccttccttctgtatatggctgcgccccaaatcaggaaaatgctgtccagtggggtgtgtacatcaactgttcagcttcctgggaaagtagttgtggtcacaggagctaatacaggtatcgggaaggagacagccaaagagctggctcagagaggagctcgagtatatttagcttgccgggatgtggaaaagggggaattggtggccaaagagatccagaccacgacagggaaccagcaggtgttggtgcggaaactggacctgtctgatactaagtctattcgagcttttgctaagggcttcttagctgaggaaaagcacctccacgttttgatcaacaatgcaggagtgatgatgtgtccgtactctaagacagcagatggctttgagatgcacataggagtcaaccacttgggtcacttcctcctaacccatctgctgctagagaaactaaaggaatcagccccatcaaggatagtaaatgtgtcttccctcgcacatcacctgggaaggatccacttccataacctgcagggcgagaaattctacaatgcaggcctggcctactgtcacagcaagctagccaacatcctcttcacccaggaactggcccggagactaaaaggctctggcgttacgacgtattctgtacaccctggcacagtccaatctgaactggttcggcactcatctttcatgagatggatgtggtggcttttctcctttttcatcaagactcctcagcagggagcccagaccagcctgcactgtgccttaacagaaggtcttgagattctaagtgggaatcatttcagtgactgtcatgtggcatgggtctctgcccaagctcgtaatgagactatagcaaggcggctgtgggacgtcagttgtgacctgctgggcctcccaatagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA fragmentation factor, 45kDa, alpha polypeptide
- ubiquitin-conjugating enzyme E2Q family member 2
- chromobox homolog 8 (Pc class homolog, Drosophila)
- protein tyrosine phosphatase, non-receptor type 7

Buy RDH11-retinol dehydrogenase 11 (all-trans/9-cis/11-cis) Gene now

Add to cart