UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene View larger

UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035012
Product type: DNA & cDNA
Ncbi symbol: UGT3A1
Origin species: Human
Product name: UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene
Size: 2ug
Accessions: BC035012
Gene id: 133688
Gene description: UDP glycosyltransferase 3 family, polypeptide A1
Synonyms: UDP-glucuronosyltransferase 3A1; UDP glycosyltransferase 3 family, polypeptide A1; UDPGT 3A1; UDP glycosyltransferase family 3 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcatcagagtggaaagtttttgatcccagatattaaagaggaggaaaaatcataccaagttatcaggtggttttcacctgaagatcatcaaaaaagaattaagaagcattttgatagctacatagaaacagcattggatggcagaaaagaatctgaagcccttgtaaagctaatggaaatatttgggactcaatgtagttatttgctaagcagaaaggatataatggattccttaaagaatgagaactatgatctggtatttgttgaagcatttgatttctgttctttcctgattgctgagaagcttgtgaaaccatttgtggccattcttcccaccacattcggctctttggattttgggctaccaagccccttgtcttatgttccagtattcccttccttgctgactgatcacatggacttctggggccgagtgaagaattttctgatgttctttagtttctccaggagccaatgggacatgcagtctacatttgacaacaccatcaaggagcatttcccagaaggctctaggccagttttgtctcatcttctactgaaagcagagttgtggtttgttaactctgattttgcctttgattttgcccggcccctgcttcccaacactgtttatattggaggcttgatggaaaaacctattaaaccagtaccacaaaatgggcaaccagctctcttcaccacccccagcttattctcctctggagtgtatcctgaaccactgagacggctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non imprinted in Prader-Willi/Angelman syndrome 1
- pseudouridylate synthase 7 homolog (S. cerevisiae)
- family with sequence similarity 108, member A1
- retinol dehydrogenase 12 (all-trans/9-cis/11-cis)

Buy UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene now

Add to cart