LYPLA1-lysophospholipase I Gene View larger

LYPLA1-lysophospholipase I Gene

PTXBC008652

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYPLA1-lysophospholipase I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LYPLA1-lysophospholipase I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008652
Product type: DNA & cDNA
Ncbi symbol: LYPLA1
Origin species: Human
Product name: LYPLA1-lysophospholipase I Gene
Size: 2ug
Accessions: BC008652
Gene id: 10434
Gene description: lysophospholipase I
Synonyms: APT-1; APT1; LPL-I; LPL1; hAPT1; acyl-protein thioesterase 1; lysoPLA I; lysophospholipid-specific lysophospholipase; lysophospholipase I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcggcaataacatgtcaaccccgctgcccgccatcgtgcccgccgcccggaaggccaccgctgcggtgattttcctgcatggattgggagatactgggcacggatgggcagaagcctttgcaggtatcagaagttcacatatcaaatatatctgcccgcatgcgcctgttaggcctgttacattaaatatgaacgtggctatgccttcatggtttgatattattgggctttcaccagattcacaggaggatgaatctgggattaaacaggcagcagaaaatataaaagctttgattgatcaagaagtgaagaatggcattccttctaacagaattattttgggagggttttctcagggaggagctttatctttatatactgcccttaccacacagcagaaactggcaggtgtcactgcactcagttgctggcttccacttcgggcttcctttccacagggtcctatcggtggtgctaatagagatatttctattctccagtgccacggggattgtgaccctttggttcccctgatgtttggttctcttacggtggaaaaactaaaaacattggtgaatccagccaatgtgacctttaaaacctatgaaggtatgatgcacagttcgtgtcaacaggaaatgatggatgtcaagcaattcattgataaactcctacctccaattgattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centromere protein H
- carbonic anhydrase VII
- exosome component 3
- testis specific, 13

Buy LYPLA1-lysophospholipase I Gene now

Add to cart