EXOSC3-exosome component 3 Gene View larger

EXOSC3-exosome component 3 Gene

PTXBC008880

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOSC3-exosome component 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOSC3-exosome component 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008880
Product type: DNA & cDNA
Ncbi symbol: EXOSC3
Origin species: Human
Product name: EXOSC3-exosome component 3 Gene
Size: 2ug
Accessions: BC008880
Gene id: 51010
Gene description: exosome component 3
Synonyms: CGI-102; PCH1B; RRP40; Rrp40p; bA3J10.7; hRrp-40; p10; exosome complex component RRP40; exosome complex exonuclease RRP40; ribosomal RNA-processing protein 40; exosome component 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaacctgcgtctgtcgcggctgaatctctcgcgggcagcagggcgcgcgctgcacgcacagtactaggtcaggtggtgctcccgggtgaggagctgctcctgccggaacaggaggacgcggaaggccctgggggtgcagtggagcgaccgttgagcctgaatgctagagcgtgctcgcgggtgcgcgttgtatgcggtccgggccttcggcgctgtggggaccgcctgctggtcaccaagtgcggccgcctccgtcacaaggagcccggcagtggcagcggcggcggtgtttactgggtggactctcagcagaagcggtatgttccagtaaaaggagaccatgtgattggcatagtgacagctaaatctggagatatattcaaagttgatgttggagggagtgagccagcttctttgtcttacttgtcatttgaaggtgcaactaaaagaaacagaccaaatgtgcaggttggagatctcatctatggccagtttgtggttgctaataaagacatggaaccagagatggtctgtattgacagctgtggacgagccaatggaatgggtgtcattggacaggatggtctgctttttaaagtgactctgggcttaattagaaagctattagctccagattgtgaaatcatacaggaagtgggaaaactctatccactggagatagtatttggaatgaatggaagaatatgggttaaggcaaaaaccatccagcagactttaattttggcaaacattttagaagcttgtgaacacatgacgtcagatcaaagaaaacagatcttctccagattggcagaaagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - testis specific, 13
- hyaluronan synthase 3
- Kruppel-like factor 6
- UBX domain protein 1

Buy EXOSC3-exosome component 3 Gene now

Add to cart