Login to display prices
Login to display prices
UBXN1-UBX domain protein 1 Gene View larger

UBXN1-UBX domain protein 1 Gene

PTXBC001372

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBXN1-UBX domain protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBXN1-UBX domain protein 1 Gene

Proteogenix catalog: PTXBC001372
Ncbi symbol: UBXN1
Product name: UBXN1-UBX domain protein 1 Gene
Size: 2ug
Accessions: BC001372
Gene id: 51035
Gene description: UBX domain protein 1
Synonyms: 2B28; SAKS1; UBXD10; UBX domain-containing protein 1; SAPK substrate protein 1; UBA/UBX 33.3 kDa protein; UBX domain protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagctgacggctcttgagagtctcatcgagatgggcttccccaggggacgcgcggagaaggctctggccctcacagggaaccagggcatcgaggctgcgatggactggctgatggagcacgaagacgaccccgatgtggacgagcctttagagactccccttggacatatcctgggacgggagcccacttcctcagagcaaggcggccttgaaggatctggttctgctgccggagaaggcaaacccgctttgagtgaagaggaaagacaggaacaaactaagaggatgttggagctggtggcccagaagcagcgggagcgtgaagaaagagaggaacgggaggcattggaacgggaacggcagcgcaggagacaagggcaagagttgtcagcagcacgacagcggctacaggaagatgagatgcgccgggctgctgaggagaggcggagggaaaaggccgaggagttagcagccagacaaagagttagagaaaagatcgagagggacaaagcagagagagccaagaagtatggtggcagtgtgggctctcagccacccccagtggcaccagagccaggtcctgttccctcttctcccagccaggagcctcccaccaagcgggagtatgaccagtgtcgcatacaggtcaggctgccagatgggacctcactgacccagacgttccgggcccgggaacagctggcagctgtgaggctctatgtggagctccaccgtggggaggaactaggtgggggccaggaccctgtgcaattgctcagtggcttccccagacgggccttctcagaagctgacatggagcggcctctgcaggagctgggtatggctgcaagactagaaaccaggactagaaactgggggagtagggaggcatgcctaggaaaaggagggatgcaaagagaaggggctttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice