NDRG2-NDRG family member 2 Gene View larger

NDRG2-NDRG family member 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDRG2-NDRG family member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDRG2-NDRG family member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011240
Product type: DNA & cDNA
Ncbi symbol: NDRG2
Origin species: Human
Product name: NDRG2-NDRG family member 2 Gene
Size: 2ug
Accessions: BC011240
Gene id: 57447
Gene description: NDRG family member 2
Synonyms: protein NDRG2; SYLD; N-myc downstream regulator 2; N-myc downstream-regulated gene 2 protein; NDR1-related protein NDR2; cytoplasmic protein Ndr1; syld709613 protein; NDRG family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagctgcaggaggtgcagatcacagaggagaagccactgttgccaggacagacgcctgaggcggccaaggaggctgagttagctgcccgaatcctcctggaccagggacagactcactctgtggagacaccatacgtctctgtcactttcactgtctatggcacccccaaacccaaacgcccagcgatccttacctaccacgatgtgggactcaactataaatcttgcttccagccactgtttcagttcgaggacatgcaggaaatcattcagaactttgtgcgggttcatgtggatgcccctggaatggaagagggagcccctgtgttccctttgggatatcagtacccatctctggaccagcttgcagacatgatcccttgcgtcctgcagtacctaaatttctctacaataattggagttggtgttggagctggagcctacatcctggcgagatatgctcttaaccacccggacactgttgaaggtcttgtcctcatcaacattgatcccaatgccaagggttggatggattgggcagcccacaagctaacaggcctcacctcttccattccggagatgatccttggacatcttttcagccaggaagagctctctggaaattctgagttgatacaaaagtacagaaatatcattacacatgcacccaacctggataacattgaattgtactggaacagctacaacaaccgccgagacctgaactttgagcgtggaggtgatatcaccctcaggtgtcctgtgatgctggtggtggaatgtaactcaaaactggaccccacccagacctcgttcctcaagatggctgactccggaggtcagccccagctgactcagccaggcaagctgaccgaggccttcaagtacttcctgcaaggcatgggctacatggcctcatcctgcatgactcgcctgtcccggtctcgtacagcctctctgaccagtgcagcatccgttgatggcaaccggtcccgctctcgcaccctgtcccagagcagcgagtctggaactctttcttcggggcccccggggcacaccatggaggtctcctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - creatine kinase, brain
- sphingosine kinase 1
- olfactomedin-like 3
- zinc finger protein 3

Buy NDRG2-NDRG family member 2 Gene now

Add to cart