Login to display prices
Login to display prices
OLFML3-olfactomedin-like 3 Gene View larger

OLFML3-olfactomedin-like 3 Gene

PTXBC009920

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OLFML3-olfactomedin-like 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OLFML3-olfactomedin-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009920
Product type: DNA & cDNA
Ncbi symbol: OLFML3
Origin species: Human
Product name: OLFML3-olfactomedin-like 3 Gene
Size: 2ug
Accessions: BC009920
Gene id: 56944
Gene description: olfactomedin-like 3
Synonyms: HNOEL-iso; OLF44; olfactomedin-like protein 3; olfactomedin like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccagcacccctctcctcatcttgttccttttgtcatggtcgggacccctccaaggacagcagcaccaccttgtggagtacatggaacgccgactagctgctttagaggaacggctggcccagtgccaggaccagagtagtcggcatgctgctgagctgcgggacttcaagaacaagatgctgccactgctggaggtggcagagaaggagcgggaggcactcagaactgaggccgacaccatctccgggagagtggatcgtctggagcgggaggtagactatctggagacccagaacccagctctgccctgtgtagagtttgatgagaaggtgactggaggccctgggaccaaaggcaagggaagaaggaatgagaagtacgatatggtgacagactgtggctacacaatctctcaagtgagatcaatgaagattctgaagcgatttggtggcccagctggtctatggaccaaggatccactggggcaaacagagaagatctacgtgttagatgggacacagaatgacacagcctttgtcttcccaaggctgcgtgacttcacccttgccatggctgcccggaaagcttcccgagtccgggtgcccttcccctgggtaggcacagggcagctggtatatggtggctttctttattttgctcggaggcctcctggaagacctggtggaggtggtgagatggagaacactttgcagctaatcaaattccacctggcaaaccgaacagtggtggacagctcagtattcccagcagaggggctgatccccccctacggcttgacagcagacacctacatcgacctggcagctgatgaggaaggtctttgggctgtctatgccacccgggaggatgacaggcacttgtgtctggccaagttagatccacagacactggacacagagcagcagtgggacacaccatgtcccagagagaatgctgaggctgcctttgtcatctgtgggaccctctatgtcgtctataacacccgtcctgccagtcgggcccgcatccagtgctcctttgatgccagcggcaccctgacccctgaacgggcagcactcccttattttccccgcagatatggtgcccatgccagcctccgctataacccccgagaacgccagctctatgcctgggatgatggctaccagattgtctataagctggagatgaggaagaaagaggaggaggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 3
- fibrinogen gamma chain
- zinc finger protein 3
- FIC domain containing