Login to display prices
Login to display prices
ZNF3-zinc finger protein 3 Gene View larger

ZNF3-zinc finger protein 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF3-zinc finger protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF3-zinc finger protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011887
Product type: DNA & cDNA
Ncbi symbol: ZNF3
Origin species: Human
Product name: ZNF3-zinc finger protein 3 Gene
Size: 2ug
Accessions: BC011887
Gene id: 7551
Gene description: zinc finger protein 3
Synonyms: A8-51; HF.12; KOX25; PP838; Zfp113; zinc finger protein 3; C2-H2 type zinc finger protein; zinc finger protein HF.12; zinc finger protein HZF3.1; zinc finger protein KOX25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaactcaggctgatctcgtatctcaggaacctcaggccctgcttgacagtgctcttccttcaaaagttcctgccttttccgacaaggacagcctgggggatgagatgttggcggctgcgctcctaaaggccaagtcccaggagctggtaacctttgaggatgtagctgtgtacttcatccggaaggagtggaagcgtttggaacctgctcagagggacctctatagagatgtgatgctggagaattacgggaatgtgttctcactggatcgtgagaccaggactgaaaatgatcaagaaatttctgaagacacaagatcacatggggtcctactgggaagatttcaaaaggatatttctcagggtctcaagtttaaagaagcctatgaacgagaagtcagtctgaaaaggccgctggggaactcccctggagaaagactgaacaggaaaatgccagattttggtcaagtgacagttgaggagaagctaacccccaggggagagagaagcgagaaatataatgattttgggaacagcttcactgtgaattccaaccttatctcacatcagagactccccgtgggagacagaccccataagtgtgatgaatgtagcaagagctttaatcgaacttcagaccttattcaacatcagagaatccacactggggaaaagccctatgaatgtaatgagtgtgggaaggccttcagccagagctcacaccttattcagcatcagagaatccacactggggaaaaaccttatgaatgtagtgattgtgggaaaaccttcagctgtagctctgccctcattctgcatcggaggatccacacgggggagaaaccctatgaatgtaatgagtgtgggaagaccttcagctggagctccaccctcacccaccatcagagaatccacactggtgagaaaccctacgcctgcaatgaatgtgggaaggccttcagcaggagctcaacccttattcaccatcagagaatccacactggagaaaaaccctatgaatgtaatgaatgtgggaaagccttcagccagagctcacacctctatcagcaccagagaatccacactggagagaagccctacgaatgtatggaatgtggaggaaagtttacctacagttcaggccttattcagcatcaaagaatccacaccggggagaacccctatgaatgtagtgagtgtgggaaagccttcaggtacagctcggctcttgttcgccatcagagaattcacactggagagaagcctttgaatgggatcggcatgagcaaaagctccctcagagttacgaccgagttaaatatcagagagtccacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FIC domain containing
- SMAD family member 5
- asparagine synthetase
- spleen tyrosine kinase