CA7-carbonic anhydrase VII Gene View larger

CA7-carbonic anhydrase VII Gene

PTXBC033865

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA7-carbonic anhydrase VII Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CA7-carbonic anhydrase VII Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033865
Product type: DNA & cDNA
Ncbi symbol: CA7
Origin species: Human
Product name: CA7-carbonic anhydrase VII Gene
Size: 2ug
Accessions: BC033865
Gene id: 766
Gene description: carbonic anhydrase VII
Synonyms: CAVII; carbonic anhydrase 7; CA-VII; carbonate dehydratase VII; carbonic anhydrase VII; carbonic dehydratase VII
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccggccaccacggctggggctacggccaggacgacggcccctcgcattggcacaagctgtatcccattgcccagggagatcgccaatcacccatcaatatcatctccagccaggctgtgtactctcccagcctgcaaccactggagctttcctatgaggcctgcatgtccctcagcatcaccaacaatggccactctgtccaggtagacttcaatgacagcgatgaccgaaccgtggtgactgggggccccctggaagggccctaccgcctcaagcagtttcacttccactggggcaagaagcacgatgtgggttctgagcacacggtggacggcaagtccttccccagcgagctgcatctggttcactggaatgccaagaagtacagcacttttggggaggcggcctcagcacctgatggcctggctgtggttggtgtttttttggagacaggagacgagcaccccagcatgaatcgtctgacagatgcgctctacatggtccggttcaagggcaccaaagcccagttcagctgcttcaaccccaagtgcctcctgcctgccagccggcactactggacctacccgggctctctgacgactcccccactcagtgagagtgtcacctggattgtgctccgggagcccatctgcatctctgaaaggcagatggggaagttccggagcctgctttttacctcggaggacgatgagaggatccacatggtgaacaacttccggccaccacagccactgaagggccgcgtggtaaaggcctccttccgggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - exosome component 3
- testis specific, 13
- hyaluronan synthase 3
- Kruppel-like factor 6

Buy CA7-carbonic anhydrase VII Gene now

Add to cart