Login to display prices
Login to display prices
CENPH-centromere protein H Gene View larger

CENPH-centromere protein H Gene

PTXBC012024

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CENPH-centromere protein H Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CENPH-centromere protein H Gene

Proteogenix catalog: PTXBC012024
Ncbi symbol: CENPH
Product name: CENPH-centromere protein H Gene
Size: 2ug
Accessions: BC012024
Gene id: 64946
Gene description: centromere protein H
Synonyms: centromere protein H; CENP-H; interphase centromere complex protein 35; kinetochore protein CENP-H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagcagccccagatgcaagacgccgacgagcccgcggactccggaggggaaggccgggcaggcgggccaccgcaggtcgccggcgcccaggcggcgtgcagcgaggaccgcatgaccctgctcctcaggctgagagcacagacaaaacaacaactcttagaatataaatcaatggttgatgcaagtgaagaaaaaactccagaacaaattatgcaagaaaagcaaatcgaagctaaaattgaagacctggaaaatgaaattgaagaggtaaaagttgcttttgagataaaaaagcttgcattagacaggatgagactttcaactgcacttaaaaaaaacctggagaaaattagcagacagtctagtgtgctcatggataacatgaaacacctattagagctaaataaattaataatgaaatcacagcaggaatcttgggatttagaggaaaaactgcttgatattagaaagaagagattgcaattaaaacaagcttcagaaagtaagcttttagaaatacagactgaaaagaacaaacagaagattgatttggacagtatggaaaactcagagaggataaagatcatacgacaaaacctacagatggagataaaaattactactgttattcaacatgtgttccagaaccttattttggggagtaaagtcaattgggcagaggatcctgcccttaaggaaattgttctgcagcttgagaagaatgttgacatgatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: