TMEM54-transmembrane protein 54 Gene View larger

TMEM54-transmembrane protein 54 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM54-transmembrane protein 54 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM54-transmembrane protein 54 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001418
Product type: DNA & cDNA
Ncbi symbol: TMEM54
Origin species: Human
Product name: TMEM54-transmembrane protein 54 Gene
Size: 2ug
Accessions: BC001418
Gene id: 113452
Gene description: transmembrane protein 54
Synonyms: BCLP; CAC-1; CAC1; transmembrane protein 54; beta-casein-like protein; protein CAC-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtctgcgcctcggaggcctgagtgtgggcgacttccggaaggtgctgatgaagacaggcctggtgctggtggtgctgggccatgtgagcttcatcacagctgccctgttccatggcacagtgctgcgctacgtgggcacccctcaagatgcggtggctctgcagtactgcgtggtcaacatcctctctgtcacttccgccatcgtggtcatcacttcaggcatcgcagccatcgtgttgtcacgctacctccctagcacccccctgcgctggacagtgtttagctcgagcgtggcctgtgctctcctttctctgacctgtgccctcggcctcttggcctccatcgccatgacctttgccacccagggcaaggcactgctggctgcctgcacttttgggagctctgaactactggccctcgcacctgactgtcccttcgaccccacacgcatttatagctccagcctgtgcctctggggcatcgccctagtgctctgcgtggcggagaacgtgtttgctgtacgctgtgctcagctcacccaccagctgctggagctgaggccctggtgggggaaaagcagccaccacatgatgcgggagaacccagagctggtggagggccgtgacctgctgagctgcaccagctctgagcctctgaccctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HEAT repeat containing 2
- transmembrane protein 33
- toll interacting protein
- N-myc (and STAT) interactor

Buy TMEM54-transmembrane protein 54 Gene now

Add to cart