Login to display prices
Login to display prices
HEATR2-HEAT repeat containing 2 Gene View larger

HEATR2-HEAT repeat containing 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEATR2-HEAT repeat containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEATR2-HEAT repeat containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010850
Product type: DNA & cDNA
Ncbi symbol: HEATR2
Origin species: Human
Product name: HEATR2-HEAT repeat containing 2 Gene
Size: 2ug
Accessions: BC010850
Gene id: 54919
Gene description: HEAT repeat containing 2
Synonyms: HEATR2; CILD18; dynein assembly factor 5, axonemal; HEAT repeat containing 2; HEAT repeat-containing protein 2; dynein axonemal assembly factor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcctgaagctgttctccatcctgtccaccgtgctgctcagagccacggacaccatcaactcccaggggcagtttcccagctacctcgagacggtgacaaaggacatcctggcccccaatctgcagtggcatgcggggaggacagccgcggccatccgcacggctgccgtgtcctgcctctgggcgctcaccagcagcgaggtcctgtcggcagagcagatacgggacgtgcaggaaacactgatgccccaggtcctgaccaccctggaggaggattcgaagatgacgcgactgatctcatgccgtattatcaacacgttcttaaaaacctcgggcggcatgacggatccagagaaactcatcaagatttatcctgaactcttaaaacgcctagatgacgtgtccaacgatgtgaggatggcagccgcctccaccttggtcacctggctgcagtgtgtcaagggtgccaacgcaaaatcctactatcagagcagtgtccagtacctgtaccgagagttgctggttcaccttgacgatccagagagggccatccaggatgcaattttagatgtgcctggttccccttcaccttctgccatgattggaagtttcctgaggcctccccacccatggagaactgtgagtcaattaaacctcttttcttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 33
- toll interacting protein
- N-myc (and STAT) interactor
- paired-like homeodomain 1