Login to display prices
Login to display prices
TOLLIP-toll interacting protein Gene View larger

TOLLIP-toll interacting protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOLLIP-toll interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TOLLIP-toll interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004420
Product type: DNA & cDNA
Ncbi symbol: TOLLIP
Origin species: Human
Product name: TOLLIP-toll interacting protein Gene
Size: 2ug
Accessions: BC004420
Gene id: 54472
Gene description: toll interacting protein
Synonyms: IL-1RAcPIP; toll-interacting protein; adapter protein; toll interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccaccgtcagcactcagcgcgggccggtgtacatcggtgagctcccgcaggacttcctccgcatcacgcccacacagcagcagcggcaggtccagctggacgcccaggcggcccagcagctgcagtacggaggcgcagtgggcaccgtgggccgactgaacatcacggtggtacaggcaaagttggccaagaattacggcatgacccgcatggacccctactgccgactgcgcctgggctacgcggtgtacgagacgcccacggcacacaatggcgccaagaatccccgctggaataaggtcatccactgcacggtgcccccaggcgtggactctttctatctcgagatcttcgatgagagagccttctccatggacgaccgcattgcctggacccacatcaccatcccagagtccctgaggcagggcaaggtggaggacaagtggtacagcctgagcgggaggcagggggacgacaaggagggcatgatcaacctcgtcatgtcctacgcgctgcttccagctgccatggtgatgccaccccagcccgtggtcctgatgccaacagtgtaccagcagggcgttggctatgtgcccatcacagggatgcccgctgtctgtagccccggcatggtgcccgtggccctgcccccggccgccgtgaacgcccagccccgctgtagcgaggaggacctgaaagccatccaggacatgttccccaacatggaccaggaggtgatccgctccgtgctggaagcccagcgagggaacaaggatgccgccatcaactccctgctgcagatgggggaggagccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-myc (and STAT) interactor
- paired-like homeodomain 1
- G protein beta subunit-like
- torsin family 3, member A