NMI-N-myc (and STAT) interactor Gene View larger

NMI-N-myc (and STAT) interactor Gene

PTXBC021987

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMI-N-myc (and STAT) interactor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NMI-N-myc (and STAT) interactor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021987
Product type: DNA & cDNA
Ncbi symbol: NMI
Origin species: Human
Product name: NMI-N-myc (and STAT) interactor Gene
Size: 2ug
Accessions: BC021987
Gene id: 9111
Gene description: N-myc (and STAT) interactor
Synonyms: N-myc-interactor; N-myc and STAT interactor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagctgataaagatgacacacaacaaattcttaaggagcattcgccagatgaatttataaaagatgaacaaaataagggactaattgatgaaattacaaagaaaaatattcagctaaggaaggagatccaaaagcttgaaacggagttacaagaggctaccaaagaattccagattaaagaggatattcctgaaacaaagatgaaattcttatcagttgaaactcctgagaatgacagccagttgtcaaatatctcctgttcgtttcaagtgagctcgaaagttccttatgagatacaaaaaggacaagcacttatcacctttgaaaaagaagaagttgctcaaaatgtggtaagcatgagtaaacatcatgtacagataaaagatgtaaatctggaggttacggccaagccagttccattaaattcaggagtcagattccaggtttatgtagaagtttctaaaatgaaaatcaatgttactgaaattcctgacacactgcgtgaagatcaaatgagagacaaactagagctgagcttttcaaagtcccgaaatggaggcggagaggtggaccgcgtggactatgacagacagtccgggagtgcagtcatcacgtttgtggagattggagtggctgacaagattttgaaaaagaaagaataccctctttatataaatcaaacttgccatagagttactgtttctccatacacagaaatacacttgaaaaagtatcagatattttcaggaacatctaagaggacagtgcttctgacaggaatggaaggcattcaaatggatgaagaaattgtggaggatttaattaacattcactttcaacgggcaaagaatggaggtggagaagtagatgtggtcaagtgttctctaggtcaacctcacatagcatactttgaagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paired-like homeodomain 1
- G protein beta subunit-like
- torsin family 3, member A
- torsin family 3, member A

Buy NMI-N-myc (and STAT) interactor Gene now

Add to cart