Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ACOT11-acyl-CoA thioesterase 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACOT11-acyl-CoA thioesterase 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACOT11 |
| Origin species: | Human |
| Product name: | ACOT11-acyl-CoA thioesterase 11 Gene |
| Size: | 2ug |
| Accessions: | BC001517 |
| Gene id: | 26027 |
| Gene description: | acyl-CoA thioesterase 11 |
| Synonyms: | BFIT; STARD14; THEA; THEM1; acyl-coenzyme A thioesterase 11; START domain containing 14; StAR-related lipid transfer (START) domain containing 14; acyl-CoA thioester hydrolase 11; adipose-associated thioesterase; brown fat-inducible thioesterase; thioesterase superfamily member 1; thioesterase, adipose associated; acyl-CoA thioesterase 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagacggcgagggataccggaaccccacggaggtgcagatgagccagctggtgctgccctgccacaccaaccaacgtggtgagctgagcgtcgggcagctgctcaagtggattgacaccacggcttgcctgtccgcggagaggcacgctggctgcccctgtgtcacagcttccatggatgacatctattttgagcacaccattagtgttggacaagtggtgaatatcaaggccaaggtgaaccgggccttcaactccagcatggaggtgggcatccaggtggcctcggaggacctgtgctctgagaagcagtggaatgtgtgcaaggccttggccaccttcgtggcccgccgagagatcaccaaggtgaagctgaagcagatcacgccgcggacagaagaggagaagatggagcacagtgtggcggctgagcgccggcgcatgcgccttgtctatgcagacaccatcaaggacctcctggccaactgcgccattcagggcgatctggagagcagagactgtagccgcatggtgccggctgagaagacccgtgtggagagtgtggagctggtcctgcctccccacgccaatcaccagggcaacacctttgggggccagatcatggcctggatggagaatgtggccaccattgcagccaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 54 - HEAT repeat containing 2 - transmembrane protein 33 - toll interacting protein |