Login to display prices
Login to display prices
ACOT11-acyl-CoA thioesterase 11 Gene View larger

ACOT11-acyl-CoA thioesterase 11 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACOT11-acyl-CoA thioesterase 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACOT11-acyl-CoA thioesterase 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001517
Product type: DNA & cDNA
Ncbi symbol: ACOT11
Origin species: Human
Product name: ACOT11-acyl-CoA thioesterase 11 Gene
Size: 2ug
Accessions: BC001517
Gene id: 26027
Gene description: acyl-CoA thioesterase 11
Synonyms: BFIT; STARD14; THEA; THEM1; acyl-coenzyme A thioesterase 11; START domain containing 14; StAR-related lipid transfer (START) domain containing 14; acyl-CoA thioester hydrolase 11; adipose-associated thioesterase; brown fat-inducible thioesterase; thioesterase superfamily member 1; thioesterase, adipose associated; acyl-CoA thioesterase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagacggcgagggataccggaaccccacggaggtgcagatgagccagctggtgctgccctgccacaccaaccaacgtggtgagctgagcgtcgggcagctgctcaagtggattgacaccacggcttgcctgtccgcggagaggcacgctggctgcccctgtgtcacagcttccatggatgacatctattttgagcacaccattagtgttggacaagtggtgaatatcaaggccaaggtgaaccgggccttcaactccagcatggaggtgggcatccaggtggcctcggaggacctgtgctctgagaagcagtggaatgtgtgcaaggccttggccaccttcgtggcccgccgagagatcaccaaggtgaagctgaagcagatcacgccgcggacagaagaggagaagatggagcacagtgtggcggctgagcgccggcgcatgcgccttgtctatgcagacaccatcaaggacctcctggccaactgcgccattcagggcgatctggagagcagagactgtagccgcatggtgccggctgagaagacccgtgtggagagtgtggagctggtcctgcctccccacgccaatcaccagggcaacacctttgggggccagatcatggcctggatggagaatgtggccaccattgcagccaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 54
- HEAT repeat containing 2
- transmembrane protein 33
- toll interacting protein