Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRAPPC4-trafficking protein particle complex 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRAPPC4-trafficking protein particle complex 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010866 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRAPPC4 |
| Origin species: | Human |
| Product name: | TRAPPC4-trafficking protein particle complex 4 Gene |
| Size: | 2ug |
| Accessions: | BC010866 |
| Gene id: | 51399 |
| Gene description: | trafficking protein particle complex 4 |
| Synonyms: | CGI-104; HSPC172; PTD009; SBDN; SYNBINDIN; TRS23; trafficking protein particle complex subunit 4; TRS23 homolog; hematopoietic stem/progenitor cell protein 172; trafficking protein particle complex 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgatttttagtgtgtatgtggtgaacaaagctggcggcttgatttaccagttggacagctacgcgccacgggctgaggctgagaaaactttcagttatccgctggatctgctgctcaagctacacgatgagcgtgtgttggttgctttcggccagcgggacggcatccgagtgggtcatgcagtgctggccatcaatggcatggacgtgaatggcaggtacacggccgacgggaaagaggtgctggagtatctgggtaaccctgctaattacccggtgtccattcgatttggccggccccgcctcacttctaatgagaagcttatgctggcctccatgtttcactcgctctttgccatcggctcccagctgtctcctgaacagggaagctcaggcattgagatgctggagacagacacattcaaattgcactgctaccagacactgacagggatcaagtttgtggttctagcagatcctaggcaagctggaatagattctcttctccgaaagatttatgagatttactcagactttgccctcaagaatccattctattccttagaaatgcctatcaggtgtgagctctttgaccagaacctgaagctagctctggaggtggcagagaaggctggaacttttggacctgggtcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cell death-inducing DFFA-like effector c - 2,4-dienoyl CoA reductase 2, peroxisomal - fragile X mental retardation 1 neighbor - cytokine inducible SH2-containing protein |