CLEC4D-C-type lectin domain family 4, member D Gene View larger

CLEC4D-C-type lectin domain family 4, member D Gene

PTXBC032313

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC4D-C-type lectin domain family 4, member D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC4D-C-type lectin domain family 4, member D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032313
Product type: DNA & cDNA
Ncbi symbol: CLEC4D
Origin species: Human
Product name: CLEC4D-C-type lectin domain family 4, member D Gene
Size: 2ug
Accessions: BC032313
Gene id: 338339
Gene description: C-type lectin domain family 4, member D
Synonyms: CD368; CLEC-6; CLEC6; CLECSF8; MCL; MPCL; C-type lectin domain family 4 member D; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8; C-type lectin receptor; C-type lectin superfamily member 8; C-type lectin-like receptor 6; macrophage C-type lectin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctagaaaaacctcaaagtaaactggaaggaggcatgcatccccagctgataccttcggttattgctgtagttttcatcttacttctcagtgtctgttttattgcaagttgtttggtgactcatcacaacttttcacgctgtaagagaggcacaggagtgcacaagttagagcaccatgcaaagctcaaatgcatcaaagagaaatcagaactgaaaagtgctgaagggagcacctggaactgttgtcctattgactggagagccttccagtccaactgctattttcctcttactgacaacaagacgtgggctgagagtgaaaggaactgttcagggatgggggcccatctgatgaccatcagcacggaagctgagcagaactttattattcagtttctggatagacggctttcctatttccttggacttagagatgagaatgccaaaggtcagtggcgttgggtggaccagacgccatttaacccacgcagagtattctggcataagaatgaacccgacaactctcagggagaaaactgtgttgttcttgtttataaccaagataaatgggcctggaatgatgttccttgtaactttgaagcaagtaggatttgtaaaatacctggaacaacattgaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 4
- cell death-inducing DFFA-like effector c
- 2,4-dienoyl CoA reductase 2, peroxisomal
- fragile X mental retardation 1 neighbor

Buy CLEC4D-C-type lectin domain family 4, member D Gene now

Add to cart