Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CLEC4D-C-type lectin domain family 4, member D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLEC4D-C-type lectin domain family 4, member D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032313 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLEC4D |
| Origin species: | Human |
| Product name: | CLEC4D-C-type lectin domain family 4, member D Gene |
| Size: | 2ug |
| Accessions: | BC032313 |
| Gene id: | 338339 |
| Gene description: | C-type lectin domain family 4, member D |
| Synonyms: | CD368; CLEC-6; CLEC6; CLECSF8; MCL; MPCL; C-type lectin domain family 4 member D; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8; C-type lectin receptor; C-type lectin superfamily member 8; C-type lectin-like receptor 6; macrophage C-type lectin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggctagaaaaacctcaaagtaaactggaaggaggcatgcatccccagctgataccttcggttattgctgtagttttcatcttacttctcagtgtctgttttattgcaagttgtttggtgactcatcacaacttttcacgctgtaagagaggcacaggagtgcacaagttagagcaccatgcaaagctcaaatgcatcaaagagaaatcagaactgaaaagtgctgaagggagcacctggaactgttgtcctattgactggagagccttccagtccaactgctattttcctcttactgacaacaagacgtgggctgagagtgaaaggaactgttcagggatgggggcccatctgatgaccatcagcacggaagctgagcagaactttattattcagtttctggatagacggctttcctatttccttggacttagagatgagaatgccaaaggtcagtggcgttgggtggaccagacgccatttaacccacgcagagtattctggcataagaatgaacccgacaactctcagggagaaaactgtgttgttcttgtttataaccaagataaatgggcctggaatgatgttccttgtaactttgaagcaagtaggatttgtaaaatacctggaacaacattgaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - trafficking protein particle complex 4 - cell death-inducing DFFA-like effector c - 2,4-dienoyl CoA reductase 2, peroxisomal - fragile X mental retardation 1 neighbor |