Login to display prices
Login to display prices
FAM73B-family with sequence similarity 73, member B Gene View larger

FAM73B-family with sequence similarity 73, member B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM73B-family with sequence similarity 73, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM73B-family with sequence similarity 73, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009114
Product type: DNA & cDNA
Ncbi symbol: FAM73B
Origin species: Human
Product name: FAM73B-family with sequence similarity 73, member B Gene
Size: 2ug
Accessions: BC009114
Gene id: 84895
Gene description: family with sequence similarity 73, member B
Synonyms: protein FAM73B; FAM73B; C9orf54; mitoguardin 2; family with sequence similarity 73, member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgacaggcctgatgaccaaggctgagaagagccccaaaggcttcctggagagctacgaggagatgctgagctatgccctgcggcccgagacctgggccacaacacggctggagctggagggccgaggggtggtatgcatgagcttcttcgacatcgtgctggacttcatcctcatggacgccttcgaggacctggagaaccctccggcctcggtgctcgccgtcctgcggaaccgctggctgtcagacagcttcaaggagacggccttggccactgcttgctggtcggtcctgaaagccaagaggaggctgctgatggtgcctgatggcttcatctcccatttctactccgtatcggagcatgtgagccctgtcctagccttcggcttccttggacccaagcctcagcttgctgaagtctgtgctttcttcaagcaccagattgtgcagtacctgagggacatgttcgacctggacaatgtgcgctacacgtcactgcccgcgctggcagacgacatcctgcagctgtcccggcgccgcagcgagatattgctggggtacctgggggtgcccgcggccagcagcgcaggcgtgaatggggcgctgccccgagagaatgggcccctgggggagctgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulointerstitial nephritis antigen-like 1
- family with sequence similarity 76, member B
- N-terminal EF-hand calcium binding protein 2
- small nuclear ribonucleoprotein polypeptide N