FAM76B-family with sequence similarity 76, member B Gene View larger

FAM76B-family with sequence similarity 76, member B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM76B-family with sequence similarity 76, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM76B-family with sequence similarity 76, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026013
Product type: DNA & cDNA
Ncbi symbol: FAM76B
Origin species: Human
Product name: FAM76B-family with sequence similarity 76, member B Gene
Size: 2ug
Accessions: BC026013
Gene id: 143684
Gene description: family with sequence similarity 76, member B
Synonyms: protein FAM76B; family with sequence similarity 76 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcctcggccctgtacgcctgcaccaagtgtacccagcgttatcctttcgaggagctctcccagggccagcagctctgcaaggaatgtcggattgcacatcctattgtaaaatgtacttactgcagatcagaatttcaacaagagagcaaaactaacacaatttgtaagaagtgtgctcaaaatgtgaagcaatttgggacgcccaagccttgtcagtactgtaacataattgcagcatttattggtaccaagtgtcagcgttgcacaaattcagaaaaaaagtatggaccacctcagacctgtgaacagtgcaaacagcaatgtgcttttgatcggaaggaggaaggaagaagaaaggttgatggaaagttattatgctggctctgtactttatcgtacaaaagagttttacagaagacgaaagaacaaaggaagagcctgggatcttcacattcaaattcatcttcttcatctcttactgagaaagaccagcatcatccaaaacatcatcaccaccatcatcaccatcaccatcgtcacagcagtagccatcacaaaatcagcaatctaagtccagaagaagagcagggactgtggaaacagagccataaatcctctgcaacaattcagaatgaaactccaaagaaaaagcccaaattggaatctaagccatctaatggagataggtgtatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-terminal EF-hand calcium binding protein 2
- small nuclear ribonucleoprotein polypeptide N
- family with sequence similarity 71, member C
- family with sequence similarity 20, member A

Buy FAM76B-family with sequence similarity 76, member B Gene now

Add to cart