SNRPN-small nuclear ribonucleoprotein polypeptide N Gene View larger

SNRPN-small nuclear ribonucleoprotein polypeptide N Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPN-small nuclear ribonucleoprotein polypeptide N Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPN-small nuclear ribonucleoprotein polypeptide N Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003180
Product type: DNA & cDNA
Ncbi symbol: SNRPN
Origin species: Human
Product name: SNRPN-small nuclear ribonucleoprotein polypeptide N Gene
Size: 2ug
Accessions: BC003180
Gene id: 6638
Gene description: small nuclear ribonucleoprotein polypeptide N
Synonyms: SNURF-SNRPN; HCERN3; PWCR; RT-LI; SM-D; SMN; SNRNP-N; sm-N; small nuclear ribonucleoprotein-associated protein N; SM protein N; sm protein D; tissue-specific splicing protein; small nuclear ribonucleoprotein polypeptide N
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgttggcaagagtagcaagatgctgcagcacattgactatagaatgagatgtatcctgcaagatggccgaatcttcattggcacctttaaggcttttgacaagcatatgaatttgatcctctgtgattgtgatgagttcagaaagatcaagccaaagaatgcgaagcaaccagagcgtgaagaaaagcgggttttgggtctggtgttgctgcgtggggagaacttggtatccatgactgtggaggggccaccccccaaagatactggcattgctcgggtaccacttgctggagctgctggaggccctggggttggtagggcagctggtagaggagtaccagctggtgtgccaattccccaggcccctgctggattggcaggccctgtccgaggagttgggggaccatcccagcaggtaatgactccacagggaagaggcactgtagcagctgctgctgttgctgcgactgccagtattgctggagccccaacacagtacccaccaggacggggcactccgcccccacccgtcggcagagcaaccccacctccaggcattatggctcctccacctggtatgagaccacccatgggcccaccaattgggcttccccctgctcgagggacgccaataggcatgccgcctccgggaatgagaccccctccaccaggcattagaggtccacctcccccaggaatgcgtccaccaagaccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 71, member C
- family with sequence similarity 20, member A
- dehydrogenase/reductase (SDR family) member 1
- family with sequence similarity 49, member B

Buy SNRPN-small nuclear ribonucleoprotein polypeptide N Gene now

Add to cart