Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNRPN-small nuclear ribonucleoprotein polypeptide N Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPN-small nuclear ribonucleoprotein polypeptide N Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003180 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPN |
| Origin species: | Human |
| Product name: | SNRPN-small nuclear ribonucleoprotein polypeptide N Gene |
| Size: | 2ug |
| Accessions: | BC003180 |
| Gene id: | 6638 |
| Gene description: | small nuclear ribonucleoprotein polypeptide N |
| Synonyms: | SNURF-SNRPN; HCERN3; PWCR; RT-LI; SM-D; SMN; SNRNP-N; sm-N; small nuclear ribonucleoprotein-associated protein N; SM protein N; sm protein D; tissue-specific splicing protein; small nuclear ribonucleoprotein polypeptide N |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgttggcaagagtagcaagatgctgcagcacattgactatagaatgagatgtatcctgcaagatggccgaatcttcattggcacctttaaggcttttgacaagcatatgaatttgatcctctgtgattgtgatgagttcagaaagatcaagccaaagaatgcgaagcaaccagagcgtgaagaaaagcgggttttgggtctggtgttgctgcgtggggagaacttggtatccatgactgtggaggggccaccccccaaagatactggcattgctcgggtaccacttgctggagctgctggaggccctggggttggtagggcagctggtagaggagtaccagctggtgtgccaattccccaggcccctgctggattggcaggccctgtccgaggagttgggggaccatcccagcaggtaatgactccacagggaagaggcactgtagcagctgctgctgttgctgcgactgccagtattgctggagccccaacacagtacccaccaggacggggcactccgcccccacccgtcggcagagcaaccccacctccaggcattatggctcctccacctggtatgagaccacccatgggcccaccaattgggcttccccctgctcgagggacgccaataggcatgccgcctccgggaatgagaccccctccaccaggcattagaggtccacctcccccaggaatgcgtccaccaagaccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 71, member C - family with sequence similarity 20, member A - dehydrogenase/reductase (SDR family) member 1 - family with sequence similarity 49, member B |