FAM49B-family with sequence similarity 49, member B Gene View larger

FAM49B-family with sequence similarity 49, member B Gene

PTXBC016345

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM49B-family with sequence similarity 49, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM49B-family with sequence similarity 49, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016345
Product type: DNA & cDNA
Ncbi symbol: FAM49B
Origin species: Human
Product name: FAM49B-family with sequence similarity 49, member B Gene
Size: 2ug
Accessions: BC016345
Gene id: 51571
Gene description: family with sequence similarity 49, member B
Synonyms: protein FAM49B; BM-009; family with sequence similarity 49 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaatcttcttaaagttttgacatgcacagaccttgagcaggggccaaattttttccttgattttgaaaatgcccagcctacagagtctgagaaggaaatttataatcaggtgaatgtagtattaaaagatgcagaaggcatcttggaggacttgcagtcatacagaggagctggccacgaaatacgagaggcaatccagcatccagcagatgagaagttgcaagagaaggcatggggtgcagttgttccactagtaggcaaattaaagaaattttacgaattttctcagaggttagaagcagcattaagaggtcttctgggagccttaacaagtaccccatattctcccacccagcatctagagcgagagcaggctcttgctaaacagtttgcagaaattcttcatttcacactccggtttgatgaactcaagatgacaaatcctgccatacagaatgatttcagctattatagaagaacattgagtcgtatgaggattaaaaatgtaccggcagaaggagaaaatgaagtaaataatgaattggcaaatcgaatgtctttgttttatgctgaggcaactccaatgctgaaaaccttgagtgatgccacaacaaaatttgtatcagagaataaaaatttaccaatagaaaataccacagattgtttaagcacaatggctagtgtatgcagagtcatgctggaaacaccggaatacagaagcagatttacaaatgaagagacagtgtcattctgcttgagggtaatggtgggtgtcataatactctatgaccacgtacatccagtgggagcatttgctaaaacttccaaaattgatatgaaaggttgtatcaaagttcttaaggaccaacctcctaatagtgtggaaggtcttctaaatgctctcaggtacacaacaaaacatttgaatgatgagactacctccaagcaaattaaatccatgctgcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dehydrogenase/reductase (SDR family) member 7
- family with sequence similarity 46, member A
- peptidylprolyl isomerase (cyclophilin)-like 2
- family with sequence similarity 71, member B

Buy FAM49B-family with sequence similarity 49, member B Gene now

Add to cart