DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene View larger

DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000637
Product type: DNA & cDNA
Ncbi symbol: DHRS7
Origin species: Human
Product name: DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene
Size: 2ug
Accessions: BC000637
Gene id: 51635
Gene description: dehydrogenase/reductase (SDR family) member 7
Synonyms: CGI-86; SDR34C1; retDSR4; retSDR4; dehydrogenase/reductase SDR family member 7; dehydrogenase/reductase (SDR family) member 7; retinal short-chain dehydrogenase/reductase 4; short chain dehydrogenase/reductase family 34C member 1; dehydrogenase/reductase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactgggagctgctgctgtggctgctggtgctgtgcgcgctgctcctgctcttggtgcagctgctgcgcttcctgagggctgacggcgacctgacgctactatgggccgagtggcagggacgacgcccagaatgggagctgactgatatggtggtgtgggtgactggagcctcgagtggaattggtgaggagctggcttaccagttgtctaaactaggagtttctcttgtgctgtcagccagaagagtgcatgagctggaaagggtgaaaagaagatgcctagagaatggcaatttaaaagaaaaagatatacttgttttgccccttgacctgaccgacactggttcccatgaagcggctaccaaagctgttctccaggagtttggtagaatcgacattctggtcaacaatggtggaatgtcccagcgttctctgtgcatggataccagcttggatgtctacagaaagctaatagagcttaactacttagggacggtgtccttgacaaaatgtgttctgcctcacatgatcgagaggaagcaaggaaagattgttactgtgaatagcatcctgggtatcatatctgtacctctttccattggatactgtgctagcaagcatgctctccggggtttttttaatggccttcgaacagaacttgccacatacccaggtataatagtttctaacatttgcccaggacctgtgcaatcaaatattgtggagaattccctagctggagaagtcacaaagactataggcaataatggagaccagtcccacaagatgacaaccagtcgttgtgtgcggctgatgttaatcagcatggccaatgatttgaaagaagtttggatctcagaacaacctttcttgttagtaacatatttgtggcaatacatgccaacctgggcctggtggataaccaacaagatggggaagaaaaggattgagaactttaagagtggtgtggatgcagactcttcttattttaaaatctttaagacaaaacatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 46, member A
- peptidylprolyl isomerase (cyclophilin)-like 2
- family with sequence similarity 71, member B
- family with sequence similarity 71, member B

Buy DHRS7-dehydrogenase/reductase (SDR family) member 7 Gene now

Add to cart