Login to display prices
Login to display prices
FAM20A-family with sequence similarity 20, member A Gene View larger

FAM20A-family with sequence similarity 20, member A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM20A-family with sequence similarity 20, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM20A-family with sequence similarity 20, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036222
Product type: DNA & cDNA
Ncbi symbol: FAM20A
Origin species: Human
Product name: FAM20A-family with sequence similarity 20, member A Gene
Size: 2ug
Accessions: BC036222
Gene id: 54757
Gene description: family with sequence similarity 20, member A
Synonyms: FAM20A, golgi associated secretory pathway pseudokinase; protein FAM20A; pseudokinase FAM20A; AI1G; AIGFS; FP2747; family with sequence similarity 20, member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacagagagcagatgaaccttacctccctggaccccccactgcagctccgactcgaggccagctgggtccagttccacctgggtattaaccgccatgggctctactcccggtccagccctgttgtcagcaaacttctgcaagacatgaggcactttcccaccatcagtgctgattacagtcaagatgagaaagccttgctgggggcatgtgactgcacccagattgtgaaacccagtggggtccacctcaagctggtgctgaggttctcggatttcgggaaggccatgttcaaaccccatgagcagcgagatgaggagacaccagtggacttcttctacttcattgactttcagagacacaatgctgagatcgcagctttccatctggacaggattctggacttccgacgggtgccgccaacagtggggaggatagtaaatgtcaccaaggaaatcctagaggtcaccaagaatgaaatcctgcagagtgttttctttgtctctccagcgagcaacgtgtgcttcttcgccaagtgtccatacatgtgcaagacggagtatgctgtctgtggcaacccacacctgctggagggttccctctctgccttcctgccgtccctcaacctggcccccaggctgtctgtgcccaacccctggatccgctcctacacactggcaggaaaagaggaccccaggacttcttctccccctcaggtgggaggtcaatcccctttactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dehydrogenase/reductase (SDR family) member 1
- family with sequence similarity 49, member B
- dehydrogenase/reductase (SDR family) member 7
- family with sequence similarity 46, member A