Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009048 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TINAGL1 |
| Origin species: | Human |
| Product name: | TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC009048 |
| Gene id: | 64129 |
| Gene description: | tubulointerstitial nephritis antigen-like 1 |
| Synonyms: | ARG1; LCN7; LIECG3; TINAGRP; tubulointerstitial nephritis antigen-like; OLRG-2; P3ECSL; TIN Ag-related protein; TIN-Ag-RP; TINAG-like 1; androgen-regulated gene 1; glucocorticoid-inducible protein 5; lipocalin 7; oxidized-LDL responsive gene 2; tubulointerstitial nephritis antigen-related protein; tubulointerstitial nephritis antigen like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgcctgtcctgtcgccccagaacctgctgtcttgtgacacccaccagcagcagggctgccgcggtgggcgtctcgatggtgcctggtggttcctgcgtcgccgaggggtggtgtctgaccactgctaccccttctcgggccgtgaacgagacgaggctggccctgcgcccccctgtatgatgcacagccgagccatgggtcggggcaagcgccaggccactgcccactgccccaacagctatgttaataacaatgacatctaccaggtcactcctgtctaccgcctcggctccaacgacaaggagatcatgaaggagctgatggagaatggccctgtccaagccctcatggaggtgcatgaggacttcttcctatacaagggaggcatctacagccacacgccagtgagccttgggaggccagagagataccgccggcatgggacccactcagtcaagatcacaggatggggagaggagacgctgccagatggaaggacgctcaaatactggactgcggccaactcctggggcccagcctggggcgagaggggccacttccgcatcgtgcgcggcgtcaatgagtgcgacatcgagagcttcgtgctgggcgtctggggccgcgtgggcatggaggacatgggtcatcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 76, member B - N-terminal EF-hand calcium binding protein 2 - small nuclear ribonucleoprotein polypeptide N - family with sequence similarity 71, member C |