Login to display prices
Login to display prices
TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene View larger

TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene

PTXBC009048

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene

Proteogenix catalog: PTXBC009048
Ncbi symbol: TINAGL1
Product name: TINAGL1-tubulointerstitial nephritis antigen-like 1 Gene
Size: 2ug
Accessions: BC009048
Gene id: 64129
Gene description: tubulointerstitial nephritis antigen-like 1
Synonyms: ARG1; LCN7; LIECG3; TINAGRP; tubulointerstitial nephritis antigen-like; OLRG-2; P3ECSL; TIN Ag-related protein; TIN-Ag-RP; TINAG-like 1; androgen-regulated gene 1; glucocorticoid-inducible protein 5; lipocalin 7; oxidized-LDL responsive gene 2; tubulointerstitial nephritis antigen-related protein; tubulointerstitial nephritis antigen like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgcctgtcctgtcgccccagaacctgctgtcttgtgacacccaccagcagcagggctgccgcggtgggcgtctcgatggtgcctggtggttcctgcgtcgccgaggggtggtgtctgaccactgctaccccttctcgggccgtgaacgagacgaggctggccctgcgcccccctgtatgatgcacagccgagccatgggtcggggcaagcgccaggccactgcccactgccccaacagctatgttaataacaatgacatctaccaggtcactcctgtctaccgcctcggctccaacgacaaggagatcatgaaggagctgatggagaatggccctgtccaagccctcatggaggtgcatgaggacttcttcctatacaagggaggcatctacagccacacgccagtgagccttgggaggccagagagataccgccggcatgggacccactcagtcaagatcacaggatggggagaggagacgctgccagatggaaggacgctcaaatactggactgcggccaactcctggggcccagcctggggcgagaggggccacttccgcatcgtgcgcggcgtcaatgagtgcgacatcgagagcttcgtgctgggcgtctggggccgcgtgggcatggaggacatgggtcatcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: