Login to display prices
Login to display prices
TMEM208-transmembrane protein 208 Gene View larger

TMEM208-transmembrane protein 208 Gene

PTXBC013412

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM208-transmembrane protein 208 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM208-transmembrane protein 208 Gene

Proteogenix catalog: PTXBC013412
Ncbi symbol: TMEM208
Product name: TMEM208-transmembrane protein 208 Gene
Size: 2ug
Accessions: BC013412
Gene id: 29100
Gene description: transmembrane protein 208
Synonyms: HSPC171; transmembrane protein 208
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccaagggcaaagtgggcacgagagggaagaagcagatatttgaagagaacagagagactctgaagttctacctgcggatcatactgggggccaatgccatttactgccttgtgacgttggtcttcttttactcatctgcctcattttgggcctggttggccctgggctttagtctggcagtgtatggggccagctaccactctatgagctcgatggcacgagcagcgttctctgagtatggggccctgatggatggtggcatggacctcaacatggagcagggcatggcagagcaccttaaggatgtgatcctactgacagccatcgtgcaggtgctcagctgcttctctctctatgtctggtccttctggcttctggctccaggccgggccctttacctcctgtgggtgaatgtgctgggcccctggttcactgcagacagtggcaccccagcaccagagcacaatgagaaacggcagcgccgacaggagcggcggcagatgaagcggttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: