TMEM208-transmembrane protein 208 Gene View larger

TMEM208-transmembrane protein 208 Gene

PTXBC013412

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM208-transmembrane protein 208 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM208-transmembrane protein 208 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013412
Product type: DNA & cDNA
Ncbi symbol: TMEM208
Origin species: Human
Product name: TMEM208-transmembrane protein 208 Gene
Size: 2ug
Accessions: BC013412
Gene id: 29100
Gene description: transmembrane protein 208
Synonyms: HSPC171; transmembrane protein 208
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccaagggcaaagtgggcacgagagggaagaagcagatatttgaagagaacagagagactctgaagttctacctgcggatcatactgggggccaatgccatttactgccttgtgacgttggtcttcttttactcatctgcctcattttgggcctggttggccctgggctttagtctggcagtgtatggggccagctaccactctatgagctcgatggcacgagcagcgttctctgagtatggggccctgatggatggtggcatggacctcaacatggagcagggcatggcagagcaccttaaggatgtgatcctactgacagccatcgtgcaggtgctcagctgcttctctctctatgtctggtccttctggcttctggctccaggccgggccctttacctcctgtgggtgaatgtgctgggcccctggttcactgcagacagtggcaccccagcaccagagcacaatgagaaacggcagcgccgacaggagcggcggcagatgaagcggttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 87A
- COMM domain containing 10
- transmembrane protein 125
- PRELI domain containing 1

Buy TMEM208-transmembrane protein 208 Gene now

Add to cart